Author
![]() |
Hammond, Rosemarie |
![]() |
HERNANDEZ, E - UNIVERSITY OF COSTA RICA |
![]() |
MORA, F - UNIVERSITY OF COSTA RICA |
![]() |
RAMIREZ, P - UNIVERSITY OF COSTA RICA |
|
Submitted to: Phytopathology
Publication Type: Peer Reviewed Journal Publication Acceptance Date: 7/19/2005 Publication Date: 4/21/2005 Citation: Hammond, R., Hernandez, E., Mora, F., Ramirez, P. 2005. First report of beet pseudo-yellows virus in cucurbita moschata and c. pepo in costa rica. Plant Disease. 89:1130. Interpretive Summary: In early 2004, severe yellowing and chlorosis were observed in field-grown cucurbits in Costa Rica. Symptoms resembled those caused by a group of whitefly-transmitted plant viruses, the criniviruses, and large populations of whiteflies were observed in the fields and on symptom-bearing plants. Studies were conducted by an ARS scientist in Beltsville, Maryland and collaborators in Costa Rica to identify the causal agent(s). Results of molecular analyses revealed that a crinivirus, Beet pseudo-yellows virus (BPYV), is associated with the disease in Cucurbita moschata Duch. (ayote) and Cucurbita pepo L.(escalopini). This is the first report of BPYV in Costa Rica. This information has been communicated to growers in Costa Rica and is being used to assess the incidence of the virus and the economic impact on cucurbit production. The results impact U.S. agriculture as the greenhouse whitefly which transmits BPYV, a wide host range virus, is emerging as a serious threat to vegetable and fruit production in California. Technical Abstract: In early 2004, severe yellowing and chlorosis were observed in field-grown cucurbits in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae) and large populations of whiteflies were observed in the fields and on symptomatic plants. To identify the causal agent of the disease, leaf samples of symptomatic plants were collected from several farms. The leaf samples were dried using silica gel. Total RNA was extracted from leaf tissue of 10 representative samples using TRI Reagent and reverse transcription-polymerase chain reactions (RT-PCR) were performed using the Titan One-Tube RT-PCR kit and primers specific for genes of cucurbit-infecting criniviruses, including the coat protein gene of Cucurbit yellow stunting disorder virus, and the minor coat protein gene (CPm) of Beet pseudo-yellows virus (BPYV). Primers specific for the heat shock protein (HSP) gene (CYHSPF 5’ gagcgccgcacaagtcatc 3’ and CYHSPR 5’ taccgccaccaaagtcatacatta 3’) of Cucumber yellows virus (CYV, a strain of BPYV) were designed based on published sequence data. In addition, primers specific for Cucurbit aphid-borne yellows luteovirus and melon yellowing-associated flexivirus were used in RT-PCR reactions. Amplified DNA fragments of 333 bp and 452 bp were obtained in two samples and only in reactions containing BPYV and CYV primer sets, respectively. Nucleotide sequence analysis of purified PCR products verified their identity as variants of BPYV, with 97% and 99% sequence identity with reported CPm and HSP sequences, respectively. The two samples, from Cucurbita moschata Duch. (ayote) and Cucurbita pepo L.(escalopini), were taken from a region around Paraiso, Cartago, Costa Rica. To our knowledge, this is the first report of BPYV in Costa Rica. The economic impact on cucurbit production has not yet been determined. Studies are underway to determine the prevalence and genetic variability of BPYV isolates in Costa Rica. |
