Author
![]() |
Mollov, Dimitre |
![]() |
CHILVERS, MARTIN - Michigan State University |
![]() |
JACOBS, JANETTE - Michigan State University |
|
Submitted to: Plant Disease
Publication Type: Research Notes Publication Acceptance Date: 7/12/2014 Publication Date: 11/20/2014 Citation: Mollov, D.S., Chilvers, M., Jacobs, J. 2014. First report of Aster Yellows Phytoplasma in soybean in Michigan. Plant Disease. 98:1578. Interpretive Summary: During the summer of 2012, soybean plants in a commercial field in Clinton County, Michigan, exhibited symptoms characteristic of phytoplasmal diseases [1, 2]. Symptoms included extensive top dieback, stunting, purple stem surfaces, internal necrosis, leaf vein discoloration and bud proliferation (Figures 1 and 2). Approximately 80% of plants in a half hectare along the southern edge of the field were symptomatic, although the majority of plants in the four hectare field appeared symptomless. Total genomic DNA was extracted from both symptomatic and asymptomatic leaf samples using a Qiagen DNeasy Plant Mini Kit (Qiagen, Germantown, MD) according to manufacturer’s instructions. The DNA was used as template in direct PCR primed by the phytoplasma-universal primers P1/P7 followed by nested PCR primed by P1/AYint [3]. Reactions containing template DNA from symptomatic plants yielded ribosomal RNA gene (rDNA) amplicons of 1.8 kbp (P1/P7-primed) and 1.6 kbp (P1/AYint-primed), respectively. Reactions containing template DNA from asymptomatic plants or water did not yield amplicons. The products of PCRs primed by P1/P7 were purified using PureLink® PCR Purification kit (Life Technologies, Carlsbad CA) and cloned in a pGem T-Easy vector system (Promega, Madison WI). Three separate clones were sequenced using the sequencing primers M13For, M13Rev, SAYF nt 755, (5’- AAAGCGTGGGGAGCAAACAG), and SAYR nt 1159, (5’- TTTGACGTCGTCCCCACCTT). The sequences of all three clones were identical. A consensus (Sequencher 4.1, Gene Codes Corporation, Ann Arbor, MI) nucleotide sequence of 1830 bp was deposited in GenBank under the accession number KF528320. A BLASTN similarity search revealed that the sequence shared 100% identity to rDNA of aster yellows phytoplasma (AF222063). Additionally, analysis of the 16Sr group/subgroup classification, based on in silico RFLP analyses using iPhyClassifier [4], indicated that the soybean phytoplasma (strain "Michigan") is a member of subgroup 16SrI-B aster yellows phytoplasma subgroup. In a phylogenic tree deduced using the Neighbor Joining algorithm, strain "Michigan" clustered with other group 16SrI strains. While aster yellows phytoplasma has been previously reported in soybean in Wisconsin [2], to our knowledge this is the first report of aster yellows in soybean in Michigan. Technical Abstract: During the summer of 2012, soybean plants in a commercial field in Clinton County, Michigan, exhibited symptoms characteristic of phytoplasmal diseases [1, 2]. Symptoms included extensive top dieback, stunting, purple stem surfaces, internal necrosis, leaf vein discoloration and bud proliferation (Figures 1 and 2). Approximately 80% of plants in a half hectare along the southern edge of the field were symptomatic, although the majority of plants in the four hectare field appeared symptomless. Total genomic DNA was extracted from both symptomatic and asymptomatic leaf samples using a Qiagen DNeasy Plant Mini Kit (Qiagen, Germantown, MD) according to manufacturer’s instructions. The DNA was used as template in direct PCR primed by the phytoplasma-universal primers P1/P7 followed by nested PCR primed by P1/AYint [3]. Reactions containing template DNA from symptomatic plants yielded ribosomal RNA gene (rDNA) amplicons of 1.8 kbp (P1/P7-primed) and 1.6 kbp (P1/AYint-primed), respectively. Reactions containing template DNA from asymptomatic plants or water did not yield amplicons. The products of PCRs primed by P1/P7 were purified using PureLink® PCR Purification kit (Life Technologies, Carlsbad CA) and cloned in a pGem T-Easy vector system (Promega, Madison WI). Three separate clones were sequenced using the sequencing primers M13For, M13Rev, SAYF nt 755, (5’- AAAGCGTGGGGAGCAAACAG), and SAYR nt 1159, (5’- TTTGACGTCGTCCCCACCTT). The sequences of all three clones were identical. A consensus (Sequencher 4.1, Gene Codes Corporation, Ann Arbor, MI) nucleotide sequence of 1830 bp was deposited in GenBank under the accession number KF528320. A BLASTN similarity search revealed that the sequence shared 100% identity to rDNA of aster yellows phytoplasma (AF222063). Additionally, analysis of the 16Sr group/subgroup classification, based on in silico RFLP analyses using iPhyClassifier [4], indicated that the soybean phytoplasma (strain "Michigan") is a member of subgroup 16SrI-B aster yellows phytoplasma subgroup. In a phylogenic tree deduced using the Neighbor Joining algorithm, strain "Michigan" clustered with other group 16SrI strains. While aster yellows phytoplasma has been previously reported in soybean in Wisconsin [2], to our knowledge this is the first report of aster yellows in soybean in Michigan. |
