Skip to main content
ARS Home » Southeast Area » Booneville, Arkansas » Dale Bumpers Small Farms Research Center » Research » Publications at this Location » Publication #202490

Title: Identification of polymorphisms in the promoter region of the bovine heat shock protein gene and associations with bull calf weaning weight

Author
item STARKEY, L
item Looper, Michael
item BANKS, A
item REITER, S
item ROSENKRANS, JR, C

Submitted to: American Society of Animal Science Southern Section Meeting
Publication Type: Abstract Only
Publication Acceptance Date: 10/30/2006
Publication Date: 2/3/2007
Citation: Starkey, L., Looper, M.L., Banks, A., Reiter, S., Rosenkrans, Jr, C. 2007. Identification of polymorphisms in the promoter region of the bovine heat shock protein gene and associations with bull calf weaning weight. American Society of Animal Science Southern Section Meeting. 85:(Suppl. 2):42.

Interpretive Summary:

Technical Abstract: Our objective was to evaluate the relationship between genotypic variation of the bovine HSP-70 promoter and bull calf weaning weights and serum concentrations of HSP-70 at weaning. Blood samples were collected from 33 crossbred bull calves. Calves were sired by Angus bulls and had Brahman-cross dams. Serum concentrations of HSP-70 at weaning were determined using an ELISA. Genomic DNA was extracted from buffy coats. Specific sequences of the HSP70 promoter region were amplified using PCR with the following primers (forward: GCCAGGAAACCAGAGACAGA; reverse: CCTACGCAGGAGTAGGTGGT). Ten single nucleotide polymorphisms (SNP) were identified at positions 895 (n = 4; 12.1 %), 1013 (n = 6; 18.2 %), 1045 (n = 1; 3.0 %), 1069 (n = 7; 21.2 %), 1096 (n = 1; 3.0 %), 1117 (n = 7; 21.2 %), 1125 (n = 13; 39.4 %), 1128 (n = 6; 18.2 %), 1154 (n = 1; 3.0 %), 1204 (n = 13; 39.4 %). Serum concentrations of HSP-70 (9.8 ng/mL) were not affected (P > 0.3) by the identified polymorphisms; however, weaning weight was affected by two genotypes. Calves with the deletion at 895 tended (P = 0.1) to have heavier weaning weights than the homozygous cytosine calves (318 vs 291 kg). At base 1128, homozygous thymine bull calves were heavier (P = 0.08) than homozygous guanine bull calves. Other SNP sites were not associated with either serum HSP-70 concentrations or weaning weights. These results indicate that polymorphisms within in the promoter region of the HSP-70 gene are associated with weaning weights. The physiological mechanism of this association is not known, and warrants further study.