Author
![]() |
BANKS, A |
![]() |
Looper, Michael |
![]() |
REITER, S |
![]() |
STARKEY, L |
![]() |
FLORES, R |
![]() |
HALLFORD, D |
![]() |
ROSENKRANS, JR, C |
Submitted to: American Society of Animal Science Southern Section Meeting
Publication Type: Abstract Only Publication Acceptance Date: 10/31/2006 Publication Date: 2/3/2007 Citation: Banks, A., Looper, M.L., Reiter, S., Starkey, L., Flores, R., Hallford, D., Rosenkrans, Jr, C. 2007. Identification of single nucleotide polymorphisms within the promoter region of the bovine heat shock protein 70 gene and associations with pregnancy. American Society of Animal Science Southern Section Meeting. 85(Suppl. 2):10. Interpretive Summary: Technical Abstract: Objectives were: 1) determine genetic diversity in a promoter segment of the bovine HSP-70 gene, and 2) determine if the identified single nucleotide polymorphisms (SNPs) were related to pregnancy rates. Genomic DNA was collected from 107 Bos taurus/Bos indicus crossbred cows. Specific primers (HSP-Pro749F: GCCAGGAAACCAGAGACAGA; HSP-Pro1268R: CCTACGCAGGAGTAGGTGGT) were used for PCR amplification of a 539 base segment of the bovine HSP-70 promoter. Nine SNPs were identified. The SNPs were located at base positions 1045 (n = 7, 6.5 %), 1069 (n = 6, 5.6 %), 1096 (n = 9, 8.4 %), 1117 (n = 9, 8.4 %), 1125 (n=42, 39.3 %), 1128 (n = 42, 39.3 %), 1134 (n = 5, 4.7 %), 1154 (n = 10, 9.4 %) and 1204 (n = 35, 32.7 %). A deletion at base position 895 was present in 18 animals (16.8 %). Pregnancy rate was higher (P < 0.01) for cows that were homozygous A at the 1125 site. In addition, cows that did not have the deletion at base 895 had higher (P < 0.01) pregnancy rates than the cows exhibiting the deletion (81 vs 18 %). Cows classified as moderate body condition score (BCS) and AA at the 1125 site had higher (P < 0.1) pregnancy rates than cows with thin BCS and AA at the 1125 site; Concentrations of serum metabolites at 35 d prior to the breeding season were used as indicators of genotype by BCS interactions. Growth hormone concentrations were greater (P < 0.05) for moderate BCS and CC cows than moderate BCS and AA cows (8.6 vs 4.7 ng/mL). Cows without the deletion at 895 tended (P < 0.13) to have greater IGF-1 at 35 d prior to the breeding season than cows with the deletion (84 vs 70 ng/mL). The promoter region of the bovine HSP-70 gene is polymorphic and may be useful in selecting cows with a propensity for higher calving rates. |