Author
![]() |
TZANETAKIS, IOANNIS - OREGON STATE UNIVERSITY |
![]() |
Wintermantel, William |
![]() |
Martin, Robert |
|
Submitted to: Plant Disease
Publication Type: Peer Reviewed Journal Publication Acceptance Date: 5/1/2003 Publication Date: 11/1/2003 Citation: Tzanetakis, I., Wintermantel, W.M., Martin, R.R. First report of beet pseudo yellows virus in strawberry in the USA: a second crinivirus able to cause pallidosis disease. Plant Disease. 2003. v87 p. 1398. Interpretive Summary: We have identified Beet pseudo yellows virus in strawberry from several different production areas in the USA. The virus causes symptoms of strawberry pallidosis in indicator plants. It is transmitted by the greenhouse whitefly and can reach up to 20% infection rates in a single season. We have generated sequence information for the virus and are able to detect it by RT-PCR. The virus was found in strawberry fields in California, Maryland and Oregon. In the past few years whiteflies have become quite common in strawberry fields in southern California and on the east coast. They have not been observed as common pests in the Northwest. This is a recent pest in strawberry and the transmission of viruses by this vector suggests that vector control may be necessary in the future. It is critical to look for this virus in strawberry nurseries and consider control in the nurseries to prevent this virus from becoming a serious problem in strawberry production. Technical Abstract: During efforts to characterize strawberry pallidosis disease we identified a single strawberry plant that indexed positive for pallidosis disease by grafting, but was not infected with Strawberry pallidosis associated virus (SPaV) based on RT-PCR. Leaves of this plant were grafted onto Fragaria vesca UC-4 and UC-5 and F. virginiana UC-10 and UC-11 indicator plants. The F. vesca plants remained asymptomatic while the F. virginiana plants gave typical pallidosis symptoms that included marginal leaf chlorosis and epinasty. We extracted dsRNA from the original plant, and cloned cDNA as previously described. Sequence analysis revealed several clones that corresponded to the published sequence of the Beet pseudo yellows virus (BPYV) heat shock protein 70 homolog gene (HSP70h). We transferred the isolate to Nicotiana benthamiana using the whitefly vector, Trialeuroides vaporariorum, and re-isolated and cloned from dsRNA. Here we present the complete sequence of the HSP70h and minor coat protein (CPm) genes of the strawberry isolate of BPYV (GenBank accession Nos AY 267369 and AY 268107, respectively). Oligonucleotide primers BP CPm F ( 5' TTCATATTAAGGATGCGCAGA 3') and BP CPm R (5' TGAAAGATGTCCACTAATGATA 3') were designed to amplify a 334 nucleotide fragment of the CPm gene of the strawberry isolate of BPYV. Using this primer set, we were able to verify the presence of BPYV in one- to three-year old plants from the major strawberry producing areas of the U.S. including California, Oregon and the Mid-Atlantic States. Infection rates were highest near Watsonville, California where more than 20% of the plants tested were infected with BPYV. BPYV and the closely related SPaV pose new concerns for the U.S. strawberry industry. |
