Southern Regional Research Center (New Orleans, La) Site Logo
ARS Home About Us Helptop nav spacerContact Us En Espanoltop nav spacer
Printable VersionPrintable Version     E-mail this pageE-mail this page
Agricultural Research Service United States Department of Agriculture
Search
  Advanced Search
 
Programs and Projects
Subjects of Investigation
 

Title: A POLYMERASE CHAIN REACTION PROTOCOL FOR THE DETECTION OF CLAVIBACTER XYLI SUBSP. XYLI,THE CASUAL BACTERIUM OF SUGARCANE RATOON STUNTING DISEASE

Authors
item Pan, Yong-Bao
item Grisham, Michael
item Burner, David
item Damann, K.E. - LSU
item Wei, Q - OICD

Submitted to: Plant Disease
Publication Type: Peer Reviewed Journal
Publication Acceptance Date: December 18, 1997
Publication Date: N/A

Interpretive Summary: Ratoon stunting disease (RSD) is one of the most serious diseases in sugarcane. Control of RSD is difficult because plants infected with the bacterium that causes RSD do not show external symptoms. Since cuttings of sugarcane plants are used to plant new fields, cuttings from infected plants are a major source of spreading the disease. What is needed is a sensitive, reliable, and economical method to detect the RSD bacterium in infected plants so sugarcane growers can be advised which plants to use to plant new fields. A polymerase chain reaction (PCR) diagnostic procedure was developed that can detect a unique region in the DNA of the RSD bacterium and requires only three hours to complete. This procedure is so specific that it can distinguish the RSD bacterium from a very closely related bacterium that causes disease in Burmudagrass. Currently, these two bacteria can be distinguished only by elaborated, time-consuming tests. The impact of this newly developed diagnostic tool on sugarcane industry is that testing for the RSD disease will be more accurate and more sensitive and will probably detect RSD infection earlier in the growing season than other testing methods. It can be immediately applied to most sugarcane quarantine and disease diagnostic laboratories to help control one of the most serious sugarcane diseases in the world.

Technical Abstract: A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli (Cxx), the causal agent of sugarcane ratoon stunting disease. Generic PCR products from the intergenic transcribed spacer (ITS) region of 16S-23S ribosomal DNA of Cxx and Clavibacter xyli subsp. cynodontis (Cxc) were cloned and sequenced. Based on multiple sequence alignment among these two sequences and other non- redundant highly homologous sequences from the database, two Cxx-specific PCR primers were designed, Cxx1 (5' CCGAAGTGAGCAGATTGACC) and Cxx2 (5' ACCCTGTGTTGTTTTCAACG). These two 20-mer oligonucleotides primed the specific amplification of a 438 bp DNA product from genomic DNA samples of 21 Cxx strains. Amplification was not observed with genomic DNA of one Clavibacter xyli subsp. cynodontis (Cxc) strain, five strains f four other Clavibacter species, and two strains of two Rathayibacter species. The 438-bp PCR product also was amplified directly from cultured Cxx cells and Cxx-infected sugarcane vascular sap with an unique reaction buffer containing polyvinylpyrrolidone and ficoll. Extraction of genomic DNA was not necessary prior to PCR assay.

   
 
 
Last Modified: 06/18/2013
ARS Home | USDA.gov | Site Map | Policies and Links 
FOIA | Accessibility Statement | Privacy Policy | Nondiscrimination Statement | Information Quality | USA.gov | White House