Submitted to: Animal Genetics International Conference Proceedings
Publication Type: Abstract Only
Publication Acceptance Date: July 1, 1996
Publication Date: N/A
Technical Abstract:
The ob gene product, leptin, is synthesized in adipose tissue and presumably acts on the hypothalamus to regulate appetite and stored body fat. Two dinucleotide repeats were present in a lambda phage genomic clone containing exons 2 and 3 of the bovine ob gene. A (TA)28 repeat designated BM1501 was located approximately 2.5 kb 3' of the stop codon and the forward and reverse primers made for PCR-based genotyping were: 5' ATCCTGCAATATCTTGTCCTTC 3' and 5' GCAGTACAGGAGGAAAGAGCT 3', respectively. A (CA)17 repeat designated BM1500 was located approximately 3.6 kb 3' of the stop codon and the forward and reverse primers were: 5' GATGCAGCAGACCAAGTGG 3' and 5' CCCATTGCTAGAACCCAGG 3', respectively. Genotype data on reference parents (N=26) detected four alleles for BM1500 (50% heterozygosity) and 12 alleles for BM1501 (75% heterozygosity). Linkage analysis based on informative reference families was consistent with the previous assignment of bovine ob to a linkage group chromosome 4 based on RFLP analysis. These two closely linked microsatellites increase the polymorphism content of the bovine ob locus which could, in part, be responsible for the genetic variation observed for fat deposition in cattle.