Skip to main content
ARS Home » Southeast Area » Miami, Florida » Subtropical Horticulture Research » Docs » Cacao Primers By Upper Sequence ( 5' - 3' )

Cacao Primers By Upper Sequence ( 5' - 3' )
headline bar
Click on the column title to view the primers sorted by the respective heading.
Primer nameUpper Sequence ( 5' - 3' )Lower Sequence ( 5' - 3' )MicrosatelliteTaDyeNotes
mTcCIR040aatccgacagtctttaatccctaggccagagaattga(ac)1551NEDSame as mTcCir062
mTcCIR288acaacacaaggcaaagacccatttagcaccaac(ga)10 aa (ga)3...(ga)11486-FAM
mTcCIR254acaactccaaagaacaagggtaaacctcgtcataat(ac)21 (at)946NED
mTcCIR277accaagatcaaagtcaagaagataagaaccaagtgaagaga(ag)16 aa (ag)1151NED
mTcCIR256agaagggtgtcaacattagaacagtcaaacataagagta(ac)13 (atac)446HEX
mTcCIR273agaatgatcgcagagagacggcattagagagaga(ct)4 ac (ct)13 tt (ct)446HEX
mTcCIR076agccaaagaaaggattgaatccgagacaaag(tc)21 ttt(tc)5846HEXSame as mTcCir077
mTcCIR290agcgagagacaaagataatgactgaaatggtggtaaag(ct)19 cacc (ca)18486-FAMSame as mTcCir053
mTcCIR082atcatgtgccccttctaaggcagctaagtgttcattc(ag)6 aa(ag)746HEX
mTcCIR074attgcagaagacaacccagttatgggcgggtgaa(ga)16 gg(ga)951NED
mTcCIR280atttgtcatttgttgttgtgccttggtattgactgt(ct)8 (ca)9466-FAM
mTcCIR114cagatgaatggaataacttgcatgaacacaaacacac(tc)9(tg)5 g(tg)448NED
mTcCIR152cagtagtcaaaacatcaaagtaatccaaataataagcat(tc)9 cc(tc)1546NED
mTcCIR257catacagaaaccagaaaattatagggtaaagcgaaat(ct)7 (ca)12486-FAM
mTcCIR003catcccagtatctcatccctgctcatttctttcatatca(ct)20(ta)21** 61 6-FAM** Temperature modified from original protocol
mTcCIR247cattttataattccttctacattctttattttcact(ac)9atac (at)342HEX
SHRSTc011ccaccacccttacctttgaaacacgagactccaaaacggacg(caa)51NEDSame as SHRSTc12
SHRSTc012ccaccacccttacctttgaaacgggaaagggaaaggctgacatc(caa)51HEXSame as SHRSTc11
mTcCIR073ccagtcaaggaagtatctaatgtctgcaatgttagc(ct)4 tt(ct)2 gg(tc)8466-FAM
mTcCIR098ccagttgctaattttcttcgcacatagttttggcaat(tc)846HEXSame as mTcCir064
mTcCIR281ccgctgttttggtatttcggatgaggggtggttg(tc)12 (ca)1451HEX
mTcCIR148cgtcctatcacttctctttcttgcctttacagccattt(tc)06 cc(tc)0651NED
mTcCIR095ctccttccctttctctccatcgtcttcctctcatc(tc)4 cc (tc)2148HEX
mTcCIR097cttcttctggtcaatcttctgctgcatccatcatcc(tc)3 c(tc)10466-FAM
mTcCIR181ctttatgctgtctctcgtaccaagaatgttttgatactg(ct)12(ca)946NEDSame as mTcCir046
mTcCIR169cttttggctgtatgttcgctgccctctctttctcac(ga)9 aa(gt)751HEX
mTcCIR274gaaaggtaaatggctgaacgatcatcacgactgct(ct)6 cacg (ca)6 (ct)2486-FAM
mTcCIR236gaagtcaaaggaaagtcaatcagaaaacgcaaataaa(ct)5 tt (ct)14 t (ct)251HEX
mTcCIR116gaattttgtgatgatggaaccagaggacttgaggcttat(ga)16 aa(ga)1048NED
mTcCIR064gagaaagtaaaaggagagagtgttagagaaatgagaagtg(ga)1146HEXSame as mTcCir098
mTcCIR136gaggaggtgagagccaggtttgtatttttgattgag(ga)7 gc(ga)748NED
mTcCIR199gattcttatttgattttccttagcacggttacatttattaca(tg)14 tc (tg)746NED
mTcCIR080gctggggtttctttgtattttctcatttctttattgggtt(ct)10 cc(ct)2466-FAM
mTcCIR070ggtatgaaggattgagagttcctattcgtatttatggg(ga)11 aa(ga)4466-FAM
mTcCIR223ggtccacactcaacactttattccattttcatttact(tc)4 gc (tc)2 gc (tc)1546NED
mTcCIR021gtcgttgttgatgtcggtggtgagtgtgtgtgtttgtct(tc)11N5(ca)12** 61 6-FAM** Temperature modified from original protocol
mTcCIR062gttatgtgtatgcttaggcaaatcacacaaacacaaat(gt)2046NEDSame as mTcCir040
mTcCIR077gttctcccccactctctaataaataaataaacaatacg(tc)946NEDSame as mTcCir076
mTcCIR086taacaaggaaaatgctctcgttgaaccgaaggaaag(ct)8 tt (ct)648NED
mTcCIR258taactcacaatccatcatatggtcattatcaaaatc(tc)7 (ac)10466-FAM
mTcCIR209tacgggctaatggtgaaggtatgctgtatttatggt(tg)6 tat (ga)948NED
mTcCIR285tactacctctaccctcttgtataaattccttcccttct(ag)16 46NED
mTcCIR046tatgctctctctcgtataatcaagaatgttttgatactga(ct)15(ca)1346HEXSame as mTcCir181
mTcCIR224tcagaaagcaatgtggtaaagcaatatcaagtggtaag(tc)13 (ac)848HEX
mTcCIR269tcgtcattaccatttgttaatgtctgcaatgttagc(ct)4 tt (ct)2 gt (ct)648NED
mTcCIR251tctatgggatttgatgagagatacagcaggaacaca(ct)7 (ca)1246HEX
mTcCIR249tctcaagttcaagggtctgacacaaatgccgttat(ct)4 tt (ct)28 (ac)1648NED
mTcCIR202tctctcatagctcaagcacctgagtcaaagtgtcct(tg)7 (ga)9486-FAM
mTcCIR012tctgaccccaaacctgtaattccagttaaagcacat(cata)4N18(tg)6** 59 NED** Temperature modified from original protocol
mTcCIR078tgaaaatacgttctgtctgacaaaaagttttctgaaagtc(tc)2 t(tc)946HEX
mTcCIR131tgagtaagaaaaagtagaaaagatcatcggtaaagtaaaat(ga)9 c(ga)446NED
mTcCIR100tgatggaataaactaagaacataagaagccaggtcagg(ag)6 c(ag)448NED
mTcCIR244tggcaataacaatgaacaattttgatgattgatgaaga(ta)4 cata (ca)17 (ta)446NED
mTcCIR278tggcatctgtctgtcgtatatgaccgtttgtag(tctg)3 (tc)10 (ta)8426-FAM
mTcCIR198tgggaccataaggaaatccccaggtgaagtaagaca(ca)3 ta(ca)646HEX
mTcCIR282tggtgaggggagagaaagcaaaggcaataataatg(ga)2 gg (ga)6486-FAM
mTcCIR268tgtaatccaaataataagcatcagtgaagaggcaagaga(ga)17 gg (ga)948NED
mTcCIR270ttagtgagatggtgacaataatcaaggaaaagttatca(ct)10 (ca)946NED
mTcCIR214ttatggcaatggcagaggatttttttatggctactt(ca)18 (ta)746NED
mTcCIR053ttgactgaaatggtggtaacagttgactgttgacttgaa(gt)2651HEXSame as mTcCir290
mTcCIR272tttgcctttcctttcttttgtcaatttggatagtg(ct)5 (tc)4...(at)4 (ca)748NED

-mTcCIR primers developed in CIRAD, Montpellier, France
-SHRSTc primers developed in USDA-SHRS Miami, Florida, USA