Skip to main content
ARS Home » Southeast Area » Miami, Florida » Subtropical Horticulture Research » Docs » Cacao Primers By Microsatellite

Cacao Primers By Microsatellite
headline bar

Theobroma cacao microsatellite primers developed by CIRAD and USDA-Miami.

Click on the column title to view the primers sorted by the respective heading.

Primer nameUpper Sequence ( 5' - 3' )Lower Sequence ( 5' - 3' )MicrosatelliteTaDyeNotes
SHRSTc029ccatttaatttagcagcaccatttcgtcgcttactacg(aaagt)51HEX
mTcCIR252aatgtgtgctttgtttctattcaagggcgtaactc(ac)1046HEX
mTcCIR255tttacctccaccatctttggcacttatctattactgt(ac)1148HEX
mTcCIR057tgtagatgtgattttatagtttgggagggataagaagcag(ac)1346HEX
mTcCIR256agaagggtgtcaacattagaacagtcaaacataagagta(ac)13 (atac)446HEX
mTcCIR040aatccgacagtctttaatccctaggccagagaattga(ac)1551NEDSame as mTcCir062
mTcCIR260tggcaacacatacattagtgtatgcctagatgaga(ac)17466-FAM
mTcCIR254acaactccaaagaacaagggtaaacctcgtcataat(ac)21 (at)946NED
mTcCIR250cccagaggaccatcacactgctctctctctactcatc(ac)2248HEX
mTcCIR253tggctactaaacacctactagggaggggagtaagtt(ac)746HEX
mTcCIR203gtggatttgggtgggatattgtgttttggctatgttc(ac)851HEX
mTcCIR183gttatcttagtttctagccacgtagtcttacaccttgattg(ac)946NED
mTcCIR247cattttataattccttctacattctttattttcact(ac)9atac (at)342HEX
SHRSTc002gagagagaaaacgagagctgcccaagtaaaatattgcaaccc(ag)64.6HEX
SHRSTc003gaacagtgtgaggaatatggtgcccagggtttggagaaaatag(ag)51NED
SHRSTc004tggatgagtcacacgatagtagcgcatcttttccctttttacac(ag)516-FAM
SHRSTc018gttttatttcccaccgttgactggttccagtcaagtc(ag)516-FAM
SHRSTc019gtcactgattccattctgtaagtgcgtcaaatatggttctg(ag)51NED
SHRSTc021cgattagagaaaccataagcaccaagtagaagtaagactcctcc(ag)51NED
SHRSTc022ttaccgctgtgtgtttagttttctccttcttcttcctc(ag)51HEX
SHRSTc023gttcctttttcttcttcagcacaaactcaaccccttttac(ag)516-FAM
SHRSTc024tagggaacttccacacacttttaatgctggagctgc(ag)51NED
SHRSTc025caaaaacaaacactttcccccaagcacgaaaaggtaaaac(ag)516-FAM
SHRSTc031agttcctctacccatacagggccagtaagaaggtaaag(ag)52NED
SHRSTc032ttgtgggaaaccaaggaggtaatgtgatgtgggtgag(ag)526-FAM
SHRSTc033ttaagggggtatgcagtgcgcaaaaacaagtatgacc(ag)52NED
SHRSTc034ccaacattatctcatcactccgctctccactatgaaggt(ag)526-FAM
mTcCIR159tgggcgatgccaaaagccacagaactatgtcataggct(ag)07516-FAM
mTcCIR157actaatgctgttggcttctcactcgactcgactgtc(ag)0948HEX
mTcCIR163cataacgcagaccagtgttttgatcatcggcttg(ag)0948HEX
mTcCIR075cattcatctttttctttctctctccttctccaaccga(ag)10486-FAM
mTcCIR107ttgcctggaagagagagatggaaagagaaataatagt(ag)11466-FAM
mTcCIR133ggatcacatccgtttagaaatttcagccctccaa(ag)1148HEX
mTcCIR210caaaccccaaacctcaacagttatggaaattattgctcta(ag)11...(aag)4486-FAM
mTcCIR119tggacttgtgctggaacgcaagaaataaaataggaac(ag)12466-FAM
mTcCIR013cagtctaacaaaggtgagtgccccacttgacaacta(ag)1346HEX
mTcCIR024tttggggtgatttcttctgatctgtctcgtcttttggtga(ag)1346HEX
mTcCIR120tggaaagtgcttactcttatgtctagtttcaggggctct(ag)13466-FAM
mTcCIR150ctgatattgcatggaaagcaccaaattgatctg(ag)13466-FAM
mTcCIR215gcttcaactccaaatcactagcatcccgtattgtg(ag)1348HEX
mTcCIR085ttgaagtagagagttgtaagaattatggtgttggttgtgat(ag)1646NED
mTcCIR094aatttgtagggtatttgaagagccatgcccagtgagtag(ag)1651HEX
mTcCIR285tactacctctaccctcttgtataaattccttcccttct(ag)16 46NED
mTcCIR277accaagatcaaagtcaagaagataagaaccaagtgaagaga(ag)16 aa (ag)1151NED
mTcCIR130accggcggctgatctaccgcgccaaccaataaag(ag)17516-FAM
mTcCIR265tgaatgctggaaaaatgtgtgtctgctttggtttgt(ag)1848NED
mTcCIR066tatccgccagaaacagaccaacagtagagtccagagt(ag)2051NED
mTcCIR128tagagagggggtagatgatggaatgatttggagac(ag)2046HEX
mTcCIR135attagagagggggtagatgactagtggggttgacatttg(ag)2051NED
mTcCIR087taagggggcaacataaatcaaatagcgcagagacaat(ag)21486-FAM
mTcCIR082atcatgtgccccttctaaggcagctaagtgttcattc(ag)6 aa(ag)746HEX
mTcCIR100tgatggaataaactaagaacataagaagccaggtcagg(ag)6 c(ag)448NED
mTcCIR110gtgaaaagtggggattgtaaagtaagagtggtgatggt(ag)8486-FAM
mTcCIR219gcgaaccaagacaaatacatgggtggcaatttct(ag)848HEX
mTcCIR231aggaggagttgctgaacaggttccaattttgtat(ag)846NED
mTcCIR235ttcggatggcaactaactaaaacagcggaacaggta(ag)848NED
mTcCIR089agagggaaatgaaaacagcgcaatgcacagagaatagtaa(ag)951NED
mTcCIR092gttccaaatcatctcactttcgtctatttctcttcactct(ag)946NED
mTcCIR113ggaaagttacagcaagagagaacaagcccggtgaagg(ag)9516-FAM
mTcCIR238ttggctttcttttagttaaaatataatcattactttccta(ag)9466-FAM
mTcCIR284gaaatccattgctctgatggtcttctttggttga(ag)9466-FAM
SHRSTc028aggctaacccaatcaatatccttccacaactttcttcttc(agg)516-FAM
SHRSTc043gctccattttcagccatcccctttaactctcctttcc(agg)52HEX
mTcCIR197ggatttattttattgtaaactccaatgatttctacattgtcacca(at)9(gt)1846HEX
SHRSTc039tctgtatatttcagggagccactgtcgtcttgccttac(atc)52NED
mTcCIR140gattcatagtggaaacacagtggaaaacagagaggaagagt(ca)07486-FAM
mTcCIR029cgacatttcgactttcatcttttgtttctttctttttcatt(ca)1046HEX
mTcCIR032gacttactcccatcctactgattggcacactttt(ca)1046NED
mTcCIR047tttgctttcacatattgagctccaagtgttttcacca(ca)1046NED
mTcCIR195caagttgaataaagtcctaagaaaataaagaaaatgaagtaa(ca)1046NED
mTcCIR030tgaagatcctactgttgagtgataataactccttagtgg(ca)11466-FAM
mTcCIR138ctgccaagtcaagtaagttcctgtggtatcaatcaatctaat(ca)11466-FAM
mTcCIR196ctgtctaatatggattttgaacggtgtcaaatctccaagtg(ca)1146NED
mTcCIR149atgaagttatagaagggtgtccattctgaaacaaccaaag(ca)1246NED
mTcCIR054aacctcttgtcacgttagaaggcatacttactactgt(ca)15466-FAM
mTcCIR061gcagtctgaaacaagataatgactataatataaggcgaa(ca)18466-FAM
mTcCIR185atccccctgcctaaagagcctgaatgaagtaagacccaat(ca)18516-FAM
mTcCIR214ttatggcaatggcagaggatttttttatggctactt(ca)18 (ta)746NED
mTcCIR042ttgctgaagtatcttttgacgctccacccctatttg(ca)2146HEX
mTcCIR198tgggaccataaggaaatccccaggtgaagtaagaca(ca)3 ta(ca)646HEX
mTcCIR123attcccttagctttatgttatgctcgcgccctttctct(ca)4(tg)651HEX
mTcCIR055gatattgtcccattatttgttccgccttgttctc(ca)6(gcacac)546NED
mTcCIR173tccggatggcaatatgtctaccccatgattctgaact(ca)748HEX
mTcCIR175ttacaatcaacagaacctctatattgatgcgaaagtc(ca)746NED
mTcCIR177gatccttgaaaccacacataatttctctttacacattctc(ca)7466-FAM
mTcCIR201aactcccatcctacacgaggaatgcagtatcattaaatc(ca)846HEX
mTcCIR259tttcctgatttccattaagaggttccaaaatacat(ca)846HEX
mTcCIR184ggttttctagctcctccaggaaagaatgactcatacta(ca)8(ct)1348HEX
SHRSTc011ccaccacccttacctttgaaacacgagactccaaaacggacg(caa)51NEDSame as SHRSTc12
SHRSTc012ccaccacccttacctttgaaacgggaaagggaaaggctgacatc(caa)51HEXSame as SHRSTc11
SHRSTc027tgtggagcacaaggtaacgcaatagaagaggatgaagg(caa)51HEX
mTcCIR012tctgaccccaaacctgtaattccagttaaagcacat(cata)4N18(tg)6** 59 NED** Temperature modified from original protocol
mTcCIR158tgtaggttatgcagcgtgttcgatgaggggtgtagctgtttg(ct)0851HEX
mTcCIR164agaacggttcaggacaatcaggacaatgatgaagaaataag(ct)08486-FAM
mTcCIR166atgaaccactatgtaagaccattccaaaggattagcag(ct)09(ca)0848NED
mTcCIR088ctaggattccatagaagtaattggacctcaattatatgt(ct)1046NED
mTcCIR090ccacttcaaaaaccattctagcaactgtcaaccattatcta(ct)1048NED
mTcCIR091ttttgctgagtgttgctgtatccgagaaatagaataggtta(ct)1046NED
mTcCIR204attacctgccgatgaagtgggtttggaatgatgt(ct)10466-FAM
mTcCIR289cttccgccactaataaactatacataacagcagcca(ct)10466-FAM
mTcCIR270ttagtgagatggtgacaataatcaaggaaaagttatca(ct)10 (ca)946NED
mTcCIR080gctggggtttctttgtattttctcatttctttattgggtt(ct)10 cc(ct)2466-FAM
mTcCIR208gcaagcccctaaaactaaaaagcaaaagaagaaga(ct)10...(ac)1148HEX
mTcCIR156ggcaggaccaaatgataaaaccaggaacaccag(ct)1151HEX
mTcCIR165ttcacttccctccccacctgggtttggagtagcttg(ct)11516-FAM
mTcCIR217agtttccatctatattgttatattgtctacggttctct(ct)1142NED
mTcCIR218tgaccaaggaagctctcggtgggaaaggtggta(ct)1148HEX
mTcCIR275ggtttggttttggtaagactaagagagagtgatgctgaca(ct)1153HEX
mTcCIR109ggaaagtgtaggaaagtagacggaccaaaaagagcata(ct)1246HEX
mTcCIR124cagcgtcttggaataacacccacacacaagacac(ct)12466-FAM
mTcCIR271gcacctttgttatcttgggaacccactgaaact(ct)1246HEX
mTcCIR291agtcccataggttccaatcgaggttatccccaaa(ct)1251NED
mTcCIR181ctttatgctgtctctcgtaccaagaatgttttgatactg(ct)12(ca)946NEDSame as mTcCir046
mTcCIR001gcagggcaggtccagtgaagcatgggcaaccagaaaacgat(ct)1451HEX
mTcCIR081tgaaactcccatactactgaacaatctgtccattattctg(ct)1546NED
mTcCIR108ttctttgtgccctctctccttcccaacgactatc(ct)15486-FAM
mTcCIR266tcgtcgccatcatagagtcgttattcggagttca(ct)1551HEX
mTcCIR046tatgctctctctcgtataatcaagaatgttttgatactga(ct)15(ca)1346HEXSame as mTcCir181
mTcCIR145cagacttccaactcaaaacttgagaatagatggaccgat(ct)17486-FAM
mTcCIR286gttctgcttcatctgtttattcaacccacaaccat(ct)18466-FAM
mTcCIR146gcaaggtctttttacgatatggacacgtctaagttg(ct)19466-FAM
mTcCIR290agcgagagacaaagataatgactgaaatggtggtaaag(ct)19 cacc (ca)18486-FAMSame as mTcCir053
mTcCIR069tcggtgttccatcagtacatgctatgagattgaaag(ct)2046NED
mTcCIR003catcccagtatctcatccctgctcatttctttcatatca(ct)20(ta)21** 61 6-FAM** Temperature modified from original protocol
mTcCIR025cttcgtagtgaatgtaggagttaggtaggtagggttatct(ct)2146NED
mTcCIR240catacctactactgctctctagtgatttatgggacttt(ct)2246HEX
mTcCIR241cagttggagggcatttacgagtgagagagtgaagtt(ct)2351HEX
mTcCIR206catgagcaaagcaaataaagtaaaatgaaggtgtga(ct)2448HEX
mTcCIR213gatctcgcaaaactaacataagtaaaatgaaggtgtga(ct)2648NED
mTcCIR019cacaacccgtgctgattagttgttgaggttgttaggag(ct)2846HEX
mTcCIR273agaatgatcgcagagagacggcattagagagaga(ct)4 ac (ct)13 tt (ct)446HEX
mTcCIR269tcgtcattaccatttgttaatgtctgcaatgttagc(ct)4 tt (ct)2 gt (ct)648NED
mTcCIR249tctcaagttcaagggtctgacacaaatgccgttat(ct)4 tt (ct)28 (ac)1648NED
mTcCIR073ccagtcaaggaagtatctaatgtctgcaatgttagc(ct)4 tt(ct)2 gg(tc)8466-FAM
mTcCIR272tttgcctttcctttcttttgtcaatttggatagtg(ct)5 (tc)4...(at)4 (ca)748NED
mTcCIR236gaagtcaaaggaaagtcaatcagaaaacgcaaataaa(ct)5 tt (ct)14 t (ct)251HEX
mTcCIR274gaaaggtaaatggctgaacgatcatcacgactgct(ct)6 cacg (ca)6 (ct)2486-FAM
mTcCIR251tctatgggatttgatgagagatacagcaggaacaca(ct)7 (ca)1246HEX
mTcCIR257catacagaaaccagaaaattatagggtaaagcgaaat(ct)7 (ca)12486-FAM
mTcCIR122catgaaaccagaaaatcatagggtaaagcgaaat(ct)7(ca)1446HEX
mTcCIR060cgctactaacaaacatcaaaagagcaaccatcactaatca(ct)7(ca)20516-FAM
mTcCIR093gttgccactgctctcgctcccttttattgttccccatta(ct)8486-FAM
mTcCIR105gtttacaacttatcgctctgaatttgtatcccttattattta(ct)846NED
mTcCIR227acatcattaaggagaaacacaaatcacctcaaataatc(ct)8466-FAM
mTcCIR230gtggaagccttatgattatgtatttatgcccatgcagac(ct)848HEX
mTcCIR264tgctatccacaaccagttaactcacttttgccacta(ct)846NED
mTcCIR280atttgtcatttgttgttgtgccttggtattgactgt(ct)8 (ca)9466-FAM
mTcCIR086taacaaggaaaatgctctcgttgaaccgaaggaaag(ct)8 tt (ct)648NED
mTcCIR009accatgcttcctccttcaacatttataccccaacca(ct)8N15(ct)5N9(tc)1051NED
mTcCIR239ctccacagtcaaaataacattaaatcccgcaaagt(ct)946NED
mTcCIR279gtccatctacatcataagccagcaacagcatcact(ct)946HEX
mTcCIR242tttcggcattccactagtaaaaacaataatcttcaacta(ct)9...(ca)948NED
SHRSTc013aatactgctcacccgactcataaccccaaaactctgcttc(ctt)51NED
SHRSTc041ccgataactcctcaacacgtagatggagagaacgaag(ctt)52HEX
mTcCIR142ccatttacaactcccattcataaactatccatccaccctacctc(ga)08486-FAM
mTcCIR160gattgttgtttggtatgcgtgaaggtgaaggtgtg(ga)0848NED
mTcCIR065catgaaagctaagtgcctaaaaatgcgttacaagtgtg(ga)1051NED
mTcCIR067atagctccttttgacacgattctcttttccacctcttt(ga)10466-FAM
mTcCIR071cgactaaccagcagaaacctcctcctcctccat(ga)1046HEX
mTcCIR072cactaggaaagaggaagaaaagaggaagattgct(ga)10466-FAM
mTcCIR103gagagatggcttaaggataccatactattgaaacattg(ga)10466-FAM
mTcCIR104aataggaaagggtaagtgaatcaagcatataaagccaaca(ga)1046HEX
mTcCIR118tctgcctgaaaatgtctctggggcactaacttttg(ga)1046HEX
mTcCIR288acaacacaaggcaaagacccatttagcaccaac(ga)10 aa (ga)3...(ga)11486-FAM
mTcCIR007atgcgaatgacaactggtgctttcagtcctttgctt(ga)11516-FAM
mTcCIR064gagaaagtaaaaggagagagtgttagagaaatgagaagtg(ga)1146HEXSame as mTcCir098
mTcCIR084catgggacgctgcctctcttattaaattgaattctct(ga)11466-FAM
mTcCIR126aactctcactatcatccacaacaaatcatcaaacactt(ga)1146NED
mTcCIR070ggtatgaaggattgagagttcctattcgtatttatggg(ga)11 aa(ga)4466-FAM
mTcCIR018gatagctaaggggattgaggaggtaattcaatcatttgaggata(ga)12516-FAM
mTcCIR151caggggctctgtgtttaccaagaacggggaga(ga)12516-FAM
mTcCIR216actgcccaggaatcatctttgtttctgccttat(ga)1246HEX
mTcCIR191agtgtgtatgtgcatgagaaaaatcccgtgaaccaa(ga)13486-FAM
mTcCIR154ccttgtaagtgtggcaattggaacaagaggttgtca(ga)1448HEX
mTcCIR276tcctgctttttaatacatgtcctatctgcctcact(ga)14466-FAM
mTcCIR233ccagaagccaaaagagaatggattaagaaggaggaa(ga)1548HEX
mTcCIR167gtagaaccataaacaacattacaatcattaaaaatacgag(ga)1646NED
mTcCIR116gaattttgtgatgatggaaccagaggacttgaggcttat(ga)16 aa(ga)1048NED
mTcCIR074attgcagaagacaacccagttatgggcgggtgaa(ga)16 gg(ga)951NED
mTcCIR068atttagctgtagccgtttccagttgatctgcttaatg(ga)1748HEX
mTcCIR143gtgccagcctttttgatcagcccacagaactatg(ga)1751HEX
mTcCIR268tgtaatccaaataataagcatcagtgaagaggcaagaga(ga)17 gg (ga)948NED
mTcCIR111ttaataagatccaaccaacacacattcacccacaagtc(ga)18466-FAM
mTcCIR162aagattgaggtcactcaggtaagttttttgctttactcttc(ga)1948HEX
mTcCIR282tggtgaggggagagaaagcaaaggcaataataatg(ga)2 gg (ga)6486-FAM
mTcCIR002cagggagctgtgttattggtcaagttattgtcggcaaggaggat(ga)3N5(ag)2gg(ag)451NED
mTcCIR136gaggaggtgagagccaggtttgtatttttgattgag(ga)7 gc(ga)748NED
mTcCIR228ccccctgatactgtgtggaaacctaatctcgtaatatgt(ga)8486-FAM
mTcCIR099cggaaaatgaaacagacaataaaagaaaagaaccatac(ga)948NED
mTcCIR102ttgtgaaaagattgcgattgcttgttattgctactat(ga)9466-FAM
mTcCIR106acgaaaaataccctaaaaatgctgttgttgtcttgct(ga)9466-FAM
mTcCIR222ctacagaaaataggcaatatcattgtattatcaggtaga(ga)946NED
mTcCIR267cactaccccttttccttttcatggctctttttctat(ga)948HEX
mTcCIR169cttttggctgtatgttcgctgccctctctttctcac(ga)9 aa(gt)751HEX
mTcCIR131tgagtaagaaaaagtagaaaagatcatcggtaaagtaaaat(ga)9 c(ga)446NED
SHRSTc037aatctaaccagaggtccgcgatttagtaaagttgcccc(gcc)536-FAM
SHRSTc044ccaatatgtagagcatattagctctcctttatctgctccc(gt)51NED
mTcCIR044cccatcaaaagtattagaagatcaagcaatggtcaac(gt)1051HEX
mTcCIR048cagactgccgcacacttagtccatccactcctctcactc(gt)10516-FAM
mTcCIR035tttccttgtattgacctaatataaacacacttcagagat(gt)11466-FAM
mTcCIR031gcatgcttctttactccattacctgccaatgacttac(gt)1246HEX
mTcCIR189gaatagaaattttatgcactcaaacaacataggtcac(gt)1246HEX
mTcCIR037ctgggtgctgatagataaaataccctccacacaaat(gt)1546HEX
mTcCIR134cgtcccaaaatcaacacatagtctgcccttccaa(gt)1546HEX
mTcCIR034gaaattgatacaagagacaacataatcttcgcacat(gt)1646NED
mTcCIR179tttccatttctcatttctcaagatgttttcattttcgtatccaa(gt)1651NED
mTcCIR062gttatgtgtatgcttaggcaaatcacacaaacacaaat(gt)2046NEDSame as mTcCir040
mTcCIR171atttctcatttctcaagtgttatggcatttcgtagc(gt)2048HEX
mTcCIR053ttgactgaaatggtggtaacagttgactgttgacttgaa(gt)2651HEXSame as mTcCir290
mTcCIR058tttttggtgatggaactattggttaagcaacactaaact(gt)4051HEX
mTcCIR017aaggatgaaggatgtaagagagcccatacgagctgtgagt(gt)7N4(ga)1251HEX
mTcCIR245gcaaatagacagcaaatttcaaaggagtataggtaa(gt)846NED
mTcCIR045gtcattgctgtgtgcatagcattaactgtgtctg(gt)9516-FAM
mTcCIR180atggtttcgattgtctgtcaaaatctaagctgataaaac(gt)946HEX
mTcCIR244tggcaataacaatgaacaattttgatgattgatgaaga(ta)4 cata (ca)17 (ta)446NED
mTcCIR148cgtcctatcacttctctttcttgcctttacagccattt(tc)06 cc(tc)0651NED
mTcCIR144ccactgacacgcaatgaactaggacttaggaaagtgtttg(tc)0948NED
mTcCIR153gcctctcacaccattatctgtacattcattacttcactgctg(tc)0951HEX
mTcCIR117tgtggaataaaagagcaatcactggtgtagcaaatgata(tc)1046HEX
mTcCIR132gaagccatggttcagagcccagatacaaactaattaaac(tc)1046HEX
mTcCIR137cagctgtcacggaaacgcctcttaccctcatt(tc)10466-FAM
mTcCIR139cttccctccccaatctttagctctaggttttccag(tc)1051NED
mTcCIR220tgaagtgtgtgtttgtgtaccaatagagggatgtaata(tc)1048HEX
mTcCIR225aagacaaagggaagaagaaggggaagagcaaatc(tc)1048NED
mTcCIR237gaagacaaggatggagactgcaaagagagcaggaga(tc)10516-FAM
mTcCIR115gtgattcaaattcaaatatgaatagcaagagagtgatgag(tc)1146NED
mTcCIR161ttggggcactaactttttttttacattcaattccatc(tc)11466-FAM
mTcCIR226taacccaaattcaaagtctttcaacagcctcatct(tc)1146NED
mTcCIR283atcaatacccaccacacacccttttcctctttttct(tc)1148NED
mTcCIR021gtcgttgttgatgtcggtggtgagtgtgtgtgtttgtct(tc)11N5(ca)12** 61 6-FAM** Temperature modified from original protocol
mTcCIR155cttggactattggaaaacaaggatacaataaggtaaatac(tc)1246NED
mTcCIR281ccgctgttttggtatttcggatgaggggtggttg(tc)12 (ca)1451HEX
mTcCIR022attctcgcaaaaacttaggatggaaggagtgtaaatag(tc)12N146(ct)1046HEX
mTcCIR011tttggtgattattagcaggattcgatttgatgtgag(tc)13466-FAM
mTcCIR224tcagaaagcaatgtggtaaagcaatatcaagtggtaag(tc)13 (ac)848HEX
mTcCIR141tgttgcataaaacacgagttccctaaaatccttcctaacagc(tc)1451NED
mTcCIR262gtttctttgctccgtatcttttgccaaccctgtgt(tc)14486-FAM
mTcCIR056atacttttacttccttttgtcttatttttctttaccag(tc)14N(tg)1546NED
mTcCIR129cagtgaggatgaggttccgacataccagtttacataa(tc)16466-FAM
mTcCIR147tgaagcaatttgaaatctgtaaccacatcataatgatttaag(tc)1648NED
mTcCIR101gaactcaccgaagagaaacgagccgtcaccaatgc(tc)18516-FAM
mTcCIR232gctgttgtctacttttgaatcaccctttgaatcagtcta(tc)1848HEX
mTcCIR015cagccgcctcttgttagtatttgggattcttgatg(tc)1946HEX
mTcCIR078tgaaaatacgttctgtctgacaaaaagttttctgaaagtc(tc)2 t(tc)946HEX
mTcCIR261gttgatctgcttaatgttctgtagccgtttacatctattat(tc)21486-FAM
mTcCIR076agccaaagaaaggattgaatccgagacaaag(tc)21 ttt(tc)5846HEXSame as mTcCir077
mTcCIR097cttcttctggtcaatcttctgctgcatccatcatcc(tc)3 c(tc)10466-FAM
mTcCIR095ctccttccctttctctccatcgtcttcctctcatc(tc)4 cc (tc)2148HEX
mTcCIR223ggtccacactcaacactttattccattttcatttact(tc)4 gc (tc)2 gc (tc)1546NED
mTcCIR008ctagtttcccatttaccatcctcagcattttctttc(tc)5tt(tc)17ttt(ct)446HEX
mTcCIR258taactcacaatccatcatatggtcattatcaaaatc(tc)7 (ac)10466-FAM
mTcCIR028gatcaatcagaagcaaacacattaaagcagcctaccaagaaaag(tc)846NED
mTcCIR079atttttctttagcgcacttaactaccttcccacctc(tc)8486-FAM
mTcCIR083gtgtgtttgtgcatgtgtacccaacccatcacc(tc)848NED
mTcCIR096atagagaaagacccaaatcagacaacaaatttatgtaatg(tc)8466-FAM
mTcCIR098ccagttgctaattttcttcgcacatagttttggcaat(tc)846HEXSame as mTcCir064
mTcCIR112ttactttgtaggctgctgcattccactcattttgct(tc)8466-FAM
mTcCIR127cgtttgtcttgcgttcatgtgtttttgcctcttac(tc)8486-FAM
mTcCIR205ggggtttgttttatgtattgtgggatcgtcttct(tc)848HEX
mTcCIR212gagaaacacttcaggatacgtcatttggcagattta(tc)846HEX
mTcCIR229atctcggtaatagcacataacgcaatcctacaacaca(tc)848NED
mTcCIR077gttctcccccactctctaataaataaataaacaatacg(tc)946NEDSame as mTcCir076
mTcCIR168ggtagtattgaggtgcgtatgtgaatgaatggatgtgaaa(tc)9486-FAM
mTcCIR207tggttgacaaggtaaaatggatgtgcaagtaagt(tc)946HEX
mTcCIR211tggtgctaactcaaatccaaacaagaaggctaaa(tc)946HEX
mTcCIR221atgtagttgggctgtgatgttaagagggaaatgaa(tc)948NED
mTcCIR234ttgtgtcggtttgattcgaaagagagggaaagtga(tc)9486-FAM
mTcCIR263accaggagtttttcttgattagtcagctcatcattat(tc)946NED
mTcCIR287tcctttctgtttgttcctttatccgtgtctccttct(tc)948NED
mTcCIR152cagtagtcaaaacatcaaagtaatccaaataataagcat(tc)9 cc(tc)1546NED
mTcCIR188gtcctattcggtgtaactacttctgcttctctttgctc(tc)9(ac)8486-FAM
mTcCIR114cagatgaatggaataacttgcatgaacacaaacacac(tc)9(tg)5 g(tg)448NED
mTcCIR026gcattcatcaatacattcgcactcaaagttcatactac(tc)9c(ct)4tt(ct)1146NED
mTcCIR016accttcaccagctcacctaaattctactagcaaattacc(tc)9N37(tc)13466-FAM
mTcCIR243acagcagtagacgcattcaaaaggcttggcacag(tc)9...(ca)11516-FAM
mTcCIR004cgactaaaacccaaaccatcaaaattattaggcaacccgaact(tctctg)2(tc)8516-FAM
mTcCIR278tggcatctgtctgtcgtatatgaccgtttgtag(tctg)3 (tc)10 (ta)8426-FAM
mTcCIR033tgggttgaagatttggtcaacaatgaaaataggca(tg)11516-FAM
mTcCIR125catgcaaatgcttaggtgaaccacagctgacac(tg)11466-FAM
mTcCIR121catgtgcatttaggtgtctctggcttcttagtgatac(tg)1246HEX
mTcCIR190aagaaactgaagcacaatcacaaagagcataaactg(tg)1246HEX
mTcCIR010acagatggcctacacactcaagcaagcctcatactc(tg)1346NED
mTcCIR194acacacagcctaaaacgaaagggatgtgacggatatttac(tg)1446NED
mTcCIR199gattcttatttgattttccttagcacggttacatttattaca(tg)14 tc (tg)746NED
mTcCIR176tcaccaattctctgctcaatgaaattacctccttac(tg)16466-FAM
mTcCIR192tcacttcacaataatttcaagaaattgaattccagttgtag(tg)16466-FAM
mTcCIR043tcatgagaatgcatgtgctggacatgaagaagttat(tg)5(ta)(ga)15466-FAM
mTcCIR209tacgggctaatggtgaaggtatgctgtatttatggt(tg)6 tat (ga)948NED
mTcCIR170ctcttgcacggcacaggattgccccacccatacg(tg)7516-FAM
mTcCIR174tggcagcaatacttcaaatcccgatgttccactc(tg)748HEX
mTcCIR202tctctcatagctcaagcacctgagtcaaagtgtcct(tg)7 (ga)9486-FAM
mTcCIR006ttccctctaaactaccctaaattaaagcaaagcaatctaacata(tg)7(ga)13466-FAM
mTcCIR049gtaaagcacatatactaaatgtcatttaacctttgtaagaagtattca(tg)8466-FAM
mTcCIR178catctgtttgcacatatttggcttggtcccttaacac(tg)848HEX
mTcCIR186aaggctaaagaacaaatgcgtagacgtcacacaata(tg)846HEX
mTcCIR187ttcacctagtgtaatggtctgcaggcttcaatttagag(tg)848NED
mTcCIR200gccaatttctgacccacttaaaataagcccaaatac(tg)846NED
mTcCIR246tatcctctctctctgtgtatcgcagcactcaaccacta(tg)8486-FAM
mTcCIR248tgatagatttgcgtttacacccagaaaagaagaagat(tg)848HEX
mTcCIR182ctaattgttcaaggaggtcaagtgtttttggcactatc(tg)946HEX
mTcCIR193aacctgtgatggaccgaaatggtgaattaggctc(tg)9486-FAM
mTcCIR172cgttccagtgtgggtgatgttttcgctctactgcttc(tg)9(ag)4516-FAM

-mTcCIR primers developed in CIRAD, Montpellier, France
-SHRSTc primers developed in USDA-SHRS Miami, Florida, USA