Location: Molecular Plant Pathology Laboratory
Title: First report of nectarine virus M in grapefruit (Citrus x paradisi Macfad.) in association with citrus chlorotic blotch disease in Texas, USAAuthor
![]() |
Roy, Avijit |
![]() |
OURO-DJOBO, ASHRAFOU - Texas A&M Agrilife |
![]() |
Grinstead, Samuel |
![]() |
Hammond, John |
![]() |
SETAMOU, MAMOUDOU - Texas A&M Agrilife |
![]() |
ALABI, OLUFEMI - Texas A&M Agrilife |
|
Submitted to: Plant Disease
Publication Type: Peer Reviewed Journal Publication Acceptance Date: 6/25/2024 Publication Date: 6/27/2024 Citation: Roy, A., Ouro-Djobo, A., Grinstead, S.C., Hammond, J., Setamou, M., Alabi, O.J. 2024. First report of nectarine virus M in grapefruit (Citrus x paradisi Macfad.) in association with citrus chlorotic blotch disease in Texas, USA. Plant Disease. https://doi.org/10.1094/PDIS-05-24-1024-PDN. DOI: https://doi.org/10.1094/PDIS-05-24-1024-PDN Interpretive Summary: In November 2019, citrus leprosis (CiL) like symptoms grapefruit samples were collected from La Feria in Cameron County, Texas but failed to identify any CiL associated virus using RT-qPCR assays. High throughput sequencing (HTS) followed by bioinformatic analysis of archived HTS data revealed the possibility of NeVM infection in those symptomatic grapefruit samples. A trip was made during September 2023 in the same location and samples were collected from the adjacent Rio Red grapefruit blocks. A total of 12 trees with symptoms of foliar chlorotic blotch and four other trees with no apparent symptom were sampled for laboratory analysis. Multiple sets of primer pairs were designed based on contig sequences identified in HTS data. Amplicons of the expected sizes were obtained from 13 of the 16 samples with all five primer pairs resulting in 81.25% incidence of NeMV in the sampled location. Of the 13 samples with chlorotic blotch symptom, 11 tested positives for NeMV, indicating a strong correlation between the observed chlorotic blotch symptom and virus infection. Technical Abstract: During November 2019, leaf samples with citrus leprosis-like symptoms in ‘Rio Red’ grapefruit trees were collected from La Feria, Cameron County, Texas, and sent to USDA-Animal and Plant Health Inspection Service - Plant Protection Quarantine, Plant Pathogen Confirmatory Laboratory at Beltsville, Maryland for pathogen identification and confirmatory testing. Four ribo-depleted libraries were prepared for High Throughput Sequencing (HTS) analysis, using the RNA extracts of individual symptomatic grapefruit samples. HTS yielded 13.6 to 22.8 million 75bp paired raw reads per sample library but failed to identify any potential virus-like agent at the time. Recent advances in bioinformatic tools (Roy et al., 2024) prompted a revisit of the archived HTS data and several virus contigs were identified. The assembled contigs covered approximately 82% of the nectarine marafivirus M (NeVM) genome (Accession KT273413) with read depths of 4.72 to 9.96 per-nt. In addition, few Caulimoviridae and Retroviridae virus-like contigs were also identified in all four libraries. NeVM was previously discovered from budwoods of nectarine trees from California using HTS and shown to infect peach (Villamor et al., 2016), but no other biological or serological data were reported. Foliar chlorotic blotch symptoms, reminiscent of the 2019 findings, were observed in adjacent Rio Red grapefruit blocks during September 2023. Twelve symptomatic trees and 4 others with no apparent symptoms were sampled. A conventional RT-PCR primer pair, Marafi Gen-1F (5´AACATGAAGAACGGSTTCGACG 3´) and NeVM-1R (5´TTCATGGTGTGCATGGCRTTYTG 3´), was designed using HTS-derived NeVM contigs and utilized for the development of a diagnostic assay. The results of ~671 bp amplicon sequencing showed that 13 of the 16 grapefruit plants (81.25%) were positive for NeVM and shared 90.61-91.51% nt sequence identities with the nectarine isolates of NeVM (KT273411-13) but only 78% with Canadian Prunus isolate 13TF170 (MZ291915). To confirm the first report of NeVM in grapefruit trees, the archived sample (TX4) and two new isolates from La Feria, TX (LF1 and LF2) were selected for genetic analysis. The primer pair Marafi Gen-1F and NeVM-1R targeting the helicase domain of NeVM genome, successfully amplified the expected fragment size of 671 bp. The amplicon sequences of the isolates LF1 and LF2 shared a maximum 93% nt identity with isolate TX4, whereas LF1 and LF2 shared 98% nt identity between them. The converse was observed for the 1906 bp overlapping amplicon sequence obtained with the primer pairs NeVM-2F (5´CTGTTCGCCGAATGCATCAAYCT 3´) / Marafi Gen-1R (5´AGTAGTACCCGCAGAAGGTGG3´) and Marafi Gen-2F (5´CCACCTTCTGCGGGTACTACT3´)/ Marafi Gen-2R (5´CTGGAGGTGTTTTCCTTCACCTG 3´) spanning the catalytic domain and tymovirus coat protein region of NeVM. The analysis showed that the 1906 bp amplicon sequence of isolates LF1 and LF2 each shared 94-95% nt identities with isolate TX4 but shared only 91% nt identity between them. Overall, the 1906 bp amplicon of all 3 Texas grapefruit isolates shared 91 to 100% nt identity with American prunus isolates but 75% nt identity with Canadian isolate. All six amplicon sequences will be deposited in GenBank. The results confirmed the occurrence of NeVM sequence variants in grapefruit trees with foliar chlorotic blotch symptoms. To investigate the ancestor and distant relatives among prunus and citrus isolates of NeVM, a study on genome analysis of this spillover virus has been initiated. |
