Skip to main content
ARS Home » Pacific West Area » Pullman, Washington » WHGQ » Research » Publications at this Location » Publication #414791

Research Project: Ecology and Genomics of Soilborne Pathogens, Beneficial Microbes, and the Microbiome of Wheat, Barley, and Biofuel Brassicas

Location: Wheat Health, Genetics, and Quality Research

Title: First detection of aster yellows associated with phytoplasma on Camelina sativa in Montana

Author
item WEN, NUAN - Washington State University
item CHEN, CHENGCI - Montana State University
item Garland Campbell, Kimberly
item LI, CHAOFU - Montana State University
item Paulitz, Timothy

Submitted to: Plant Disease
Publication Type: Peer Reviewed Journal
Publication Acceptance Date: 11/25/2024
Publication Date: 1/4/2025
Citation: Wen, N., Chen, C., Garland Campbell, K.A., Li, C., Paulitz, T.C. 2025. First detection of aster yellows associated with phytoplasma on Camelina sativa in Montana. Plant Disease. 109(1):229. https://doi.org/10.1094/PDIS-09-24-1875-PDN.
DOI: https://doi.org/10.1094/PDIS-09-24-1875-PDN

Interpretive Summary: Plant with symptoms of a phytoplasma on camelina were found in summer 2022 in a research trial in Sydney, Montana. Plants were sampled for DNA and tested with qPCR primers specific for aster yellows. We also sequenced the PCR products and found homology <97% with aster yellows sequences in GenBank. This is the first report of aster yellows in camelina in Montana. This pathogen has also been found in Canada and N. Dakota. Camelina is a biofuels crop with increasing acreage in Montana.

Technical Abstract: Camelina (Camelina sativa) is an oilseed crop in the Brassicaceae family that can be grown as a spring or summer annual or as a biennial winter crop in a variety of climates and soil conditions (Moser 2010). It has been grown on a commercial basis in Montana for more than a decade (Grady and Nleya 2010). During the 2020 and 2021 growing seasons, camelina plants grown in plots at Sydney, MT exhibited symptoms typical of aster yellows infection. Symptoms included stunted growth, purpling of leaves, phyllody, proliferation of shoots and axillary shoots, and a reduced number or absence of pods. Plants with symptoms were approximately 4% in the 0.5-acre plots. Plants were collected from seven locations across the field, with three replicate plants per location. DNA was extracted and was amplified by nested PCR first using the primers P1 (AAGAGTTTGATCCTGGCTCAGGATT) and P6 (TGGTAGGGATACCTTGTTACGACTTA), then R16F2 (ACGACTGCTGCTAAGACTGG) and R16R2 (TGACGGGCGGTGTGTACAAACCCCG), according to the protocol described by Olivier et al. (2010). PCR products of 1200 bp were obtained from all symptomatic plants, while no amplicons were obtained from the asymptomatic plants, including the asymptomatic parts of the partially infected plant. The PCR products were sequenced, and BLAST shows that they are highly identical to the sequence of aster yellows. This suggests that the pathogen infecting camelina is aster yellows. Aster yellows has been reported on camelina in N. Dakota (Byamukama et al. 2016) and Canada (Séguin-Swartz et al. 2009). To our knowledge, this is the first detection of aster yellows on camelina in Montana. The distribution and impact of aster yellows on camelina productivity in Montana remains to be determined, but this discovery alerts the researchers and growers to be aware of the disease.