Skip to main content
ARS Home » Pacific West Area » Corvallis, Oregon » Horticultural Crops Production and Genetic Improvement Research Unit » Research » Publications at this Location » Publication #352415
Research Project: Genetic Improvement of Blackberry, Red and Black Raspberry, Blueberry, and Strawberry

Location: Horticultural Crops Production and Genetic Improvement Research Unit

Title: Strawberry necrotic shock virus (SNSV). A new virus disease in Benguet, Philippines

Author
item PINON, AURORA - Benguet State University
item Martin, Robert

Submitted to: Meeting Abstract
Publication Type: Abstract Only
Publication Acceptance Date: 5/2/2018
Publication Date: 5/8/2018
Citation: Pinon, A., Martin, R.R. 2018. Strawberry necrotic shock virus (SNSV). A new virus disease in Benguet, Philippines. Abstract for the Philippine Phytopathological Society; 2018 May 8-11; Iloilo City, Philippines.

Interpretive Summary:

Technical Abstract: The molecular identification of strawberry virus (SNVS) collected from strawberry in Benguet, Philippines was done at USDA HCR ARS Corvallis, Oregon to determine its complete genome sequence. Samples were collected from Atok, Benguet State University (BSU) Organic Farm, Pico Farm, BSU Swamp Area, and BSU Conventional Farm. Approximately 100g leaf sample was used following Martin Lab RNA extraction with silica protocol. Philippine samples as virus donor were grafted on healthy strawberry (Frgaria vesca ‘UC-5’) for bioassay. At 3 weeks after grafting, the sample from Pico Farm showed pronounced stunting and chlorosis. Total nucleic acids were extracted from leaves upon arrival and from indicator plants six weeks after grafting following Tzanetakis et al., 2007 and used for testing by RT-PCR for Beet pseudo yellows virus, SCV, Strawberry mild yellow edge virus (SMYEV), Strawberry mottle virus, Strawberry necrotic shock virus (SNSV), and Strawberry pallidosis associated virus, and tested by PCR for Strawberry vein banding virus, and phytoplasmas following Martin and Tzanetakis, 2006. The samples were also extracted for ELISA testing for SNSV and SMYEV following Martin and Tzanetakis, 2006. At three weeks after grafting, the Pico Farm samples developed pronounced stunting and chlorosis. The same sample with that from BSU Organic Farm tested positive for SNSV by ELISA. These samples were also positive for SNSV in RT-PCR assays using primers CP-F 5’ GAGTATTTCTGTAGTGAATTCTTGGA and CP-R 5’- ATTATTCTTAATGTGAGGCAACTCG.Amplicons from the two SNSV samples were sequenced at ETON Bioscience, San Diego CA using Sanger sequencing. The sequences of the amplicons derived from the strawberries directly from the Philippines (GenBank #MH078526-7) showed 91-100% and 94-100% nucleotide and amino acid sequence identity, respectively to SNSV sequences in GenBank.