Skip to main content
ARS Home » Northeast Area » Washington, D.C. » National Arboretum » Floral and Nursery Plants Research » Research » Publications at this Location » Publication #307933

Title: First report of Plantago asiatica mosaic virus in imported Asiatic and Oriental lilies (Lilium hybrids) in the United States

Author
item HAMMOND, JOHN
item BAMPI, DAIANA - UNIVERSIDADE ESTADUAL JULLO DE MESQULTA FILHO
item REINSEL, MICHAEL

Submitted to: Plant Disease
Publication Type: Peer Reviewed Journal
Publication Acceptance Date: 10/18/2014
Publication Date: 2/11/2015
Citation: Hammond, J., Bampi, D., Reinsel, M.D. 2015. First report of Plantago asiatica mosaic virus in imported Asiatic and Oriental lilies (Lilium hybrids) in the United States. Plant Disease. 99:292.

Interpretive Summary: Virus infections of many crops cause reductions in yield and quality, and vegetatively-propagated ornamental crops are prone to accumulation of viruses transmitted either mechanically or via vectored transmission in the course of crop production. Lilies are grown for their prominent flowers, and are known to be susceptible to a number of viruses. Asiatic and Oriental lily hybrids imported from the Netherlands were grown in a greenhouse in 2013, and symptoms of leaf necrosis were observed in some plants after flowering. Bioassay to test plants revealed symptoms distinct from those caused by viruses known to occur in lilies in the United States. Additional testing by reverse transcription polymerase chain reaction (RT-PCR) and Enzyme-linked immunosorbent assay (ELISA) revealed the presence of Plantago asiatica mosaic virus, not previously reported in lilies in the US. The sequence of the isolated virus was most similar to that of an isolate from lilies previously reported in the Netherlands. New primers for specific RT-PCR detection and identification of Plantago asiatica mosaic virus were developed and tested. ELISA testing of additional imported lily bulbs in 2014 detected Plantago asiatica mosaic virus in three of six cultivars each of both Asiatic lilies and Oriental lilies. Although the Nandina mosaic isolate of Plantago asiatica mosaic virus has been known in Nandina in the US since about 1978, no infection of lilies has been previously reported in the US. Significant losses in greenhouse cutflower lilies due to Plantago asiatica mosaic virus infection have been reported in the Netherlands since 2010. Knowledge of the presence of the virus in imported lily bulbs, and methods for specific detection, will allow growers to seek stocks free of this damaging virus, and will aid regulatory officials in pre-screening crops intended for import to the United States.

Technical Abstract: Asiatic and Oriental hybrid lilies (Lilium hybrids, Liliaceae) are bulbous ornamentals valued for their prominent flowers. Bulbs of several varieties of each lily type, imported from the Netherlands, were purchased in spring 2013 from retail nurseries and grown in a cool greenhouse; additional bulbs were obtained in 2014. After flowering in 2013, but prior to leaf senescence, necrotic streaking was observed in midstem leaves of several plants. RNA extracted from leaves of several individual plants was subjected to reverse transcription-polymerase chain reaction (RT-PCR) assay using NSNC-odT primed cDNA and PCR with primers PxDeg/BNSNC or potyS/BNSNC to amplify potexvirus/carlavirus and potyvirus products respectively. Sequencing of a c.1.7 kb PCR product obtained from one lily identified Lily symptomless virus (LSV). Mechanical inoculation of pooled lily leaf samples to Nicotiana benthamiana, N. glutinosa, and Chenopodium quinoa (not hosts of LSV) yielded chlorotic or necrotic local lesions on C. quinoa, and systemic mosaic with necrotic spotting, streaking, or apical necrosis on N. benthamiana; electron microscopy revealed flexuous particles typical of a potexvirus. RT-PCR from C. quinoa and N. benthamiana with PxDeg/BNSNC yielded a c.1.3 kb product which was cloned and sequenced; the consensus sequence (KM205357) has 98.7% nucleotide identity to a Dutch isolate of Plantago asiatica mosaic virus (PlAMV, KF471012; 78.5-87.8% to other isolates), and 99.0% coat protein amino acid identity to KF471012 (88.9-93.2% to other isolates). The 2013 lilies were stored overwinter at 4°C, and RNA extracted from roots of individual bulbs. Primers PlAMV CP-F2 (TTCGTCACCCTCAGCGG) and PlAMV CP-R3 (AAACGGTAAAATACACACCGGG) were designed based on alignment of KM205357 with all PlAMV sequences available in GenBank. RT-PCR using PlAMV CP-F2/CP-R3 yielded products of the anticipated 511 bp from 20 bulbs, with no product from a no-template control. ELISA of root and bulbscale samples using PlAMV-specific coating antibody and conjugate confirmed PlAMV in seven of 20 bulbs positive by RT-PCR. Bioassay of eight PCR-positive lilies on N. benthamiana, C. quinoa, and Tetragonia expansa confirmed infection in three by both symptoms and ELISA. Altogether 11/15 Asiatic lily (5/5 cvs.; America, Connecticut King, Grand Cru, Pink Pixie, and Starfighter) and nine Oriental lily (all cv. Stargazer) were found to be infected with PlAMV by RT-PCR, of which seven were confirmed by bioassay and/or ELISA. Bulbs obtained in 2014 were tested solely by ELISA; 5/18 Asiatic lily (3/6 cvs.; Connecticut King, Crimson Pixie, and Yellow Electric) and 3/13 Oriental lily (3/6 cvs.; Anastasia, Casa Blanca, and Garden Party) were found to be infected. PlAMV was reported in lilies in the Netherlands in 2010, with losses of up to 80% in greenhouse cut-flower production. The Nandina mosaic isolate of PlAMV has been known in the US since 1976, but PlAMV infection of lily has not previously been documented in the US; the degree of damage observed in the Netherlands suggests that growers should seek bulb stocks free of PlAMV.