Author
![]() |
LI, FAN - Yunnan Agricultural University |
![]() |
LI, Y Y - Yunnan Agricultural University |
![]() |
WANG, C L - Non ARS Employee |
![]() |
XIANG, D - Non ARS Employee |
![]() |
Li, Ruhui |
![]() |
LIU, Y - Hunan Academy Of Agricultural Sciences |
|
Submitted to: Plant Disease
Publication Type: Research Notes Publication Acceptance Date: 10/24/2014 Publication Date: 10/25/2014 Citation: Li, F., Li, Y., Wang, C., Xiang, D., Li, R., Liu, Y. 2014. First Report of Carnation vein mottle virus Infecting Dianthus amurensis in China. Plant Disease. 98:1447. Interpretive Summary: Technical Abstract: Tomato mottle mosaic virus (ToMMV), a tentative member in genus Tobamovirus, was first reported from a greenhouse tomato sample collected in Mexico in 2013 (1). In August 2013, foliar mottle, shrinking and necrosis were observed on pepper plants in several vegetable greenhouses of Lhasa, Tibet Autonomous Region, China. Seven symptomatic samples were collected and tested by dot-enzyme linked immunosorbent assay with antisera against Cucumber mosaic virus, Tobacco mosaic virus (TMV), Cucumber green mottle mosaic virus, Tomato spotted wilt virus, Turnip mosaic virus and Broad bean wilt virus 2 (kindly provided by Dr. Xueping Zhou of Zhejiang University, China). Only one bell pepper (Capsicum annuum var. grossum) sample reacted with the TMV antibody. Rod-shaped virus particles of 300 nm in length were also observed in this sample under electronic microscopy. The results suggested that a tobamovirus closely related to TMV might be a potential causal agent. Total nucleic acids were then extracted from all seven samples using a CTAB method (2) and tested by RT-PCR using a pair of tobamoviruses degenerate primers, TobamoF (GCWAAGGTKGTWYTBGTRGAYGG) and TobamoR (GTAATTGCTATTGDGTWCCWGC). These two primers were designed according to the conserved regions of TMV, Tomato mosaic virus and ToMMV. An amplicon of approximately 880 bp was obtained only from the positive sample. The amplicon was cloned and sequenced (GenBank Accession No. KJ605653). NCBI BLAST search showed that it shared the highest identity of 99% to ToMMV (KF477193). The results indicated that the TMV-positive plant was infected with ToMMV. To investigate the distribution and incidence of ToMMV, 313 samples of symptomatic pepper, tomato, pumpin, cucumber, radish, Chinese cabbage, broad bean, pea and kindey bean were collected from 65 fields in both Yunnan Province and Tibet and tested by ToMMV-specific RT-PCR with primers ToMMVF (AGAGAGATGGCGATAGGTTAAC) and ToMMVR (CTGCAGTCATAGGATCTACTTC). The virus was detected in three tabasco pepper plants (C. frutescens) from Yunnan and another bell pepper plant from Tibet, indicating that ToMMV has a restricted host range and is not common. To our knowledge, this is the first report of natural infection of ToMMV in peppers as well as in China. |
