Author
![]() |
Lartey, Robert |
![]() |
Caesar, Thecan |
![]() |
Hanson, Sophia |
![]() |
Evans, Robert |
|
Submitted to: International Congress of Plant Pathology Abstracts and Proceedings
Publication Type: Abstract Only Publication Acceptance Date: 5/1/2008 Publication Date: 6/1/2008 Citation: Lartey, R.T., Caesar, T., Hanson, S.L., Evans, R.G. 2008. Elisa and pcr survey for cercospora beticola in field soils from three upper midwest states of the united states. International Congress of Plant Pathology Abstracts and Proceedings. 98(6):87. Interpretive Summary: Technical Abstract: Several fields in North Dakota, Minnesota and Nebraska were examined for presence of Cercospora beticola, the causal agent of Cercospora leaf spot (CLS) of sugar beet. As part of an ongoing nationwide survey, soils were collected from several areas including sugar beet and non sugar beet growing fields. The sugar beet fields were either under beet cultivation or in rotation with other crops. Others fields include fields with no previous history of sugar beet or never been cultivated. The soils were subjected to Enzyme-Linked Immunosorbent Assay (ELISA) and PCR. The samples were subjected to ELISA using pre-adsorption C. beticola specific antibodies. For PCR, total DNA was extracted from soil samples using PowerSoil DNA Kit (MO BIO, CA) as per the manufacturer’s instructions. Target DNA fragments were amplified using Extract-N-Amp PCR mix (Sigma Aldrich, St Louis MO). The reactions were primed with C. beticola specific actin sequence based primers CBACTIN959 L (5' GTAAGTGCTGCCACAATCAGAC 3') and CBACTIN959 R (5' TACCATGACGATGTTTCCGTAG 3'). The amplicons were resolved by electrophoresis in 1% agarose gels. Using ELISA and PCR, we detected C. beticola in soil at several locations. Contrary to prevailing views, we also detected C. beticola also in field soil which are not under sugar beet cultivation. This survey identified areas even with no history of sugar beet with risk of CLS on susceptible crops. The pathogen might have been from known or yet to be identified alternate hosts. |
