Skip to main content
ARS Home » Pacific West Area » Corvallis, Oregon » Horticultural Crops Research Unit » Research » Publications at this Location » Publication #226990
Title: First Report of Rosa multiflora cryptic virus in Rosa Multiflora in the Eastern United States

Author
item Martin, Robert
item TZANETAKIS, I - UNIVERSITY OF ARKANSAS

Submitted to: Plant Disease
Publication Type: Peer Reviewed Journal
Publication Acceptance Date: 9/14/2008
Publication Date: 12/1/2008
Citation: Martin, R.R., Tzanetakis, I.E. 2008. First report of Rosa multiflora cryptic virus in Rosa multiflora in the Eastern United States. Plant Disease. 92(12):1706.

Interpretive Summary: Efforts to identify the causal agent of Rose Rosette (RR) disease has resulted in the finding of two new viruses in Rosa multiflora. One virus, Blackberry chlorotic ringspot virus has been described previously. Here we report the second virus, Rosa multiflora cryptic virus (RMCV). Four of the five plants showing RR symptoms gave two predominant double-stranded RNAbands of about 1.8 and 1.5 kb. The sizes were similar to those seen in strawberry plants infected with Fragaria chiloensis cryptic virus (FCCV), and further steps were taken for the identification of the putative virus. DsRNA was cloned and sequenced, and the sequence obtained was most closely related to FCCV at the time. Partial sequences for the two RNAs have been deposited in GenBank under accession numbers EU350962 and EU350963. Oligonucleotide primers F (5’ gaatgggaactacgctttgc 3’) and R (5’ cgatgcttccaatgatgttg 3’) designed to amplify a 196 bp region of RNA 1 of the virus were tested using ss and dsRNA templates and were determined to be virus specific after sequencing of multiple PCR amplicons. Just before submission of this manuscript, the complete sequence of Rosa multiflora cryptic virus (RMCV) isolated from R. multiflora showing rose spring dwarf symptoms was published. RMCV and the virus we isolated from Arkansas are the same species as they share 99% nucleotide sequence identity. Cryptic viruses are expected to be symptomless, though mild symptoms have been associated with a cryptic virus of Raphanus sativus. The presence of RMCV has been verified in both symptomless and plants infected with two severe diseases of rose, thus, the virus could play a role in the phenotype of these diseases. This is the first report of RMCV in the eastern United States.

Technical Abstract: In the process of identifying the rose rosette agent, double-stranded RNA was isolated from several symptomatic Rosa multiflora plants from northwest Arkansas. The pattern of the dsRNA bands differed and several viruses have been cloned including Blackberry chlorotic ringspot virus. Four of the five plants tested had two predominant bands of about 1.8 and 1.5 kb. This pattern was similar to that observed in plants infected with Fragaria chiloensis cryptic virus (FCCV), and further steps were taken for the identification of the putative virus. One plant, free of BCRV, was chosen for further characterization using DOP-PCR. Twenty clones were sequenced and all were found to be part of two contigs of 937 and 1087 nucleotides that have been deposited in GenBank under accession numbers EU350962 and EU350963. The two contigs had 82% and 72% nucleotide and 85% and 69% amino acid sequence identities with RNA 1 and 2 of FCCV, respectively. Oligonucleotide primers F (5’ gaatgggaactacgctttgc 3’) and R (5’ cgatgcttccaatgatgttg 3’) designed to amplify a 196 bp region of RNA 1 of the virus were tested using ss and dsRNA templates and were to be virus specific after sequencing of multiple PCR amplicons. Just before submission of this manuscript, the complete sequence of Rosa multiflora cryptic virus (RMCV), a virus isolated from R. multiflora showing rose spring dwarf symptoms was published. RMCV and the virus we have isolated from Arkansas are the same species as they share 99% nucleotide sequence identity. Cryptic viruses are expected to be symptomless, though mild symptoms have been associated with a cryptic virus of Raphanus sativus. The presence of RMCV has been verified in both symptomless and plants infected with two severe diseases of rose, thus, the virus could play a role in the phenotype of these diseases. This is the first report of RMCV in the eastern United States.