Skip to main content
ARS Home » Plains Area » Sidney, Montana » Northern Plains Agricultural Research Laboratory » Agricultural Systems Research » Research » Publications at this Location » Publication #209376

Title: Survey of Field Soils for Cercospora beticola by PCR and ELISA

Author
item Lartey, Robert
item Caesar, Thecan
item Iversen, William
item Hanson, Sophia
item Evans, Robert

Submitted to: Meeting Abstract
Publication Type: Abstract Only
Publication Acceptance Date: 12/1/2006
Publication Date: 2/28/2006
Citation: Lartey, R.T., Caesar, T., Iversen, W.M., Hanson, S.L., Evans, R.G. Survey of Field Soils for Cercospora beticola by PCR and ELISA. American Society of Sugar Beet Technologists, February 28-March 3, 2007, Salt Lake City, Utah. p. 29.

Interpretive Summary:

Technical Abstract: We surveyed several fields in the Lower Yellowstone River Valley (Eastern Montana and Western North Dakota) for Cercospora beticola, the causal agent of Cercospora leaf spot of sugar beet. We used both PCR based technique and ELISA for detection of C. beticola in soil. Soils were sampled from several sugar beet growing fields. The fields were either under sugar beet cultivation or in rotation with other crops such as barley and safflower. These were compared with other fields consisted of fields with no previous history of sugar beet or have never been cultivated. A soil sample from Florida where sugar beet is not known to be grown the DNA from pure C. beticola culture also serves as a control. The DNA was purified from soil using PowerSoil DNA Kit (MO BIO, CA) as per manufactures instructions. The purified DNA was then subjected to PCR in Extract-N-Amp PCR mix (Sigma Aldrich, St Louis MO) using the C. beticola specific actin primed with CBACTIN915L (5' GTAAGTGCTGCCACAATCAGAC 3') and CBACTIN915R (5' TACCATGACGATGTTTCCGTAG 3'). The amplified products were resolved by electrophoresis in 1% agarose gels. Additionally, the soil samples were subjected to ELISA using C. beticola specific antibody. Using the combination of the two techniques, we were able to identify locations which have C. beticola in the soil. The survey provides a tool for pre-planting identification of locations with potential problems for C. beticola and Cercospora Leaf Spot of sugar beet in following growing season.