Skip to main content
ARS Home » Northeast Area » Beltsville, Maryland (BARC) » Beltsville Agricultural Research Center » National Germplasm Resources Laboratory » Research » Publications at this Location » Publication #325447
Title: First report of Sugarcane mosaic virus infecting Columbus Grass (Sorghum almum) in the United States

Author
item Mollov, Dimitre
item TAHIR, MUHAMMAD - US Department Of Agriculture (USDA)
item WEI, CHUNYAN - University Of Florida
item KAYE, CLAUDIA - Us Sugar Corporation
item LOCKHART, BEN - University Of Minnesota
item COMSTOCK, JACK - US Department Of Agriculture (USDA)
item ROTT, PHILIPPE - University Of Florida

Submitted to: Plant Disease
Publication Type: Peer Reviewed Journal
Publication Acceptance Date: 2/12/2016
Publication Date: 4/1/2016
Citation: Mollov, D.S., Tahir, M., Wei, C., Kaye, C., Lockhart, B., Comstock, J., Rott, P. 2016. First report of Sugarcane mosaic virus infecting Columbus Grass (Sorghum almum) in the United States. Plant Disease. 100:1510.

Interpretive Summary: Virus infections have adverse effects on yield and quality in many crops. They tend to accumulate in vegetatively propagated crops, especially if the viruses are also transmitted by vectors during the growing season. Sugarcane is affected by several viruses, including Sugarcane mosaic virus (SCMV) which affects sugarcane yield and quality. Sorghum almum or Columbus grass is a perennial weed that is widely prevalent in sugarcane fields in Florida. In this research we report Columbus grass as a new host for SCMV. Ten Columbus grass samples collected around Florida sugarcane growing areas were all infected with SCMV. To our knowledge this is the first report of S. almum as a host of SCMV in the United States. This research provides new insights into the virus epidemiology and is useful for developing sugarcane disease management strategies.

Technical Abstract: Mosaic symptoms in sorghum can be caused by several potyviruses [family Potyviridae], including Sorghum mosaic virus (SrMV) and Sugarcane mosaic virus (SCMV). SrMV and SCMV are responsible for global economic losses in sorghum, maize, and sugarcane. Ten plants of Columbus grass (Sorghum almum) exhibiting mosaic symptoms in sugarcane production areas around Canal Point in Florida were collected during summer and fall of 2015. Partial virus purification was performed with 20 grams of leaves from one plant, and filamentous virus particles (about 750 nm long) were observed by transmission electron microscopy (TEM). This preparation was used for immunosorbent electron microscopy with Maize dwarf mosaic virus (MDMV) antibody A and MDMV antibody B (Pirone, 1972). Maize dwarf mosaic virus B antibody trapped and decorated virus particles, but the serological reaction with the MDMV A antibody was not readily observed. Five of the ten plants with mosaic symptoms all tested positive by ELISA using a broad-spectrum potyvirus antibody (Agdia, Elkhart, IN). These plants also reacted in ELISA with SCMV specific antibodies (Agdia, Elkhart, IN). Total RNA was extracted from leaves of all 10 S. almum plants using RNeasy Plant mini Kit (Qiagen, Hilden, Germany) and used as a template for RT-PCR. Poaceae potyvirus specific primer pair oligo 1n (ATG GTH TGG TGY ATH GAR AAY GG) and oligo 2n (TGC TGC KGC YTT CAT YTG) (Marie Jeanne et al. 2000) produced the expected 327 bp size amplicon in all ten samples. Five amplicons were sequenced revealing 93-95% nucleotide identity with SCMV isolates in GenBank (BLASTn). Additional cDNA was generated from two plants using primer M4T (GTT TTC CCA GTC ACG AC-(T)15), and PCR amplified using universal primers Poty S (GGN AAY AAY AGY GGN CAR CC) and M4 (GTT TTC CCA GTC ACG AC) (Chen et al., 2001) yielding an approximately 1.8 kb product. These products were cloned in pGEM®-T Easy Vector System (Promega, Madison, Wisconsin). Full-length sequences were obtained from three clones using first universal primers M13-Forward and M13-Reverse, and then plasmid specific primers SAF1-plasmid (CCTGGGTACCTAGAGGATTACA) and SAR1-plasmid (GCTGTGTGTCTCTCTGTATTCTC). The two 1.8 kb sequences were most similar to isolates of SCMV and had 92% identity to GenBank accession U57356 (SCMV strain D from sugarcane) at the nucleotide level, and 81% similarity to GenBank accession CAX36842 (SCMV from Saccharum officinarum) at the amino acid level. TEM, ISEM, ELISA, RT-PCR, and sequence analysis from multiple plants confirmed the presence of SCMV in S. almum exhibiting mosaic symptoms in Florida. SCMV has been previously reported to infect S. almum in Australia (Teakle and Grylls, 1973) but, to our knowledge, this is the first report in the U.S. This federal and state noxius weed is widely distributed in sugarcane growing areas in Florida where sugarcane also occasionally exhibits mosaic symptoms. It may be an alternative host for SCMV. The relationship between SCMV strains occurring in S. almum and strains infecting sugarcane requires investigation to determine the importance of S. almum in the epidemiology and management of SCMV in sugarcane.