Page Banner

United States Department of Agriculture

Agricultural Research Service

Title: Rapid Communication. Phosphoglycerate Kinase 1 (Pgk1) Maps to XQ1.2 in the Porcine Genome

item Rohrer, Gary

Submitted to: Journal of Animal Science
Publication Type: Abstract Only
Publication Acceptance Date: November 6, 1998
Publication Date: N/A

Technical Abstract: Source of Clone. A porcine yeast artificial chromosome (YAC) library was screened by PCR with primers developed from the human PGK1 sequence (GenBank numbers M20132 and J03180 ) and a positive clone was identified. The amplified product was verified to be PGK1 by sequence similarity to the human sequence. Total yeast DNA was used to physically assign the locu uvia fluorescence in situ hybridization to porcine metaphase chromosome spreads. Purified YAC DNA was then digested with Sau3AI, subcloned and screened for microsatellite repeats. Subclones containing microsatellites were sequenced and primers were developed to genotype the locus across the MARC porcine reference population as previously described. Two informative microsatellite markers associated with PGK1 were developed from this clone named SY8 and SY9. PCR Conditions. Reactions were conducted as previously described. The primers used to genotype SY8 and SY9 were: SY8F, ATGGGTCATATAGTCTCTTGGC; SY8R, GGAGATTAATTCCTGTCTGGTG; SY9F, CATGGCCATTTCAGTCAATG; and SY9R, CCCTTTCAGTAACCAAAAATGC, respectively. Annealing temperatures were 55o C for SY8 and 58o C for SY9. Microsatellite polymorphisms. The size of alleles observed and frequencies (in parentheses) of each allele in nine parents of the MARC swine reference population for SY8 were 164 (.06), 166 (.25), 168 (.19), 172 (.06), 176 (.13) and a null allele on the X chromosome (.31) and for SY9 were 186 (.75), and190 (.25). Both markers displayed X-linked inheritance as males only possessed one allele in 86 progeny observed. Chromosome location. The results from the fluorescence in situ hybridization indicated that the YAC probe hybridized to X q1.2 on all metaphase spreads observed.

Last Modified: 7/22/2014
Footer Content Back to Top of Page