|
Research Project:
BIOLOGY, EPIDEMIOLOGY, PATHOGENESIS, AND VECTOR SPECIFICITY OF SUGARBEET AND VEGETABLE VIRUSES
Location: Crop Improvement and Protection Research
Title: First report of Tobacco rattle virus in spinach in California.
Authors
 | Koike, S - |  | Tian, T - |  | Liu, Hsing Yeh |
Submitted to: Plant Disease
Publication Type: Peer Reviewed Journal
Publication Acceptance Date: December 8, 2009
Publication Date: January 20, 2010
Citation: Koike, S.T., Tian, T., Liu, H. 2010. First report of Tobacco rattle virus in spinach in California.. Plant Disease. 94-125.
Interpretive Summary: In 2009 in Santa Barbara County commercially grown spinach exhibited symptoms of a previously unrecognized virus-like disease. Symptoms consisted of general chlorosis and bright yellow blotches and spots. Necrotic spots were also associated with the disease. For affected fields, disease occurred in limited, irregularly shaped patches that ranged from one to several meters in diameter. Symptomatic plants were unmarketable and these small patches of spinach were not harvested. Using a transmission electron microscope, rigid rod-shaped particles with a clear central canal were observed from plant sap of the symptomatic spinach. Analysis using a DAS-ELISA assay for Tobacco rattle virus (TRV) showed that the symptomatic plants were positive. Symptomatic spinach from the field was used for mechanical transmission to Chenopodium quinoa, C. murale, C. capitatum, spinach, and sugar beet (Beta vulgaris). All inoculated plants showed chlorotic local lesions and sugar beet showed chlorotic local lesions with rings. To further confirm the presence of TRV, reverse transcription-PCR (RT-PCR) was conducted. Amplicons of the expected size (approximately 562 bp) were obtained. The RT-PCR products were sequenced and compared with TRV sequences in GenBank to confirm the identity of the products. Sequences obtained had 96% nucleotide identity and 97% amino acid identity with TRV sequences. Based on data from electron microscopy and serological and molecular analyses, the virus was identified as TRV. This is the first report of TRV in spinach in California.
Technical Abstract:
In 2009 in coastal California (Santa Barbara County), commercially grown spinach (Spinacia oleracea) in two nearby fields exhibited symptoms of a previously unrecognized virus-like disease. Symptoms consisted of general chlorosis and bright yellow blotches and spots. Necrotic spots were also associated with the disease. For affected fields, disease occurred in limited, irregularly shaped patches that ranged from one to several meters in diameter. Symptomatic plants were unmarketable and these small patches of spinach were not harvested. Using a transmission electron microscope, rigid rod-shaped particles with a clear central canal were observed from plant sap of the symptomatic spinach. Analysis using a DAS-ELISA assay (Agdia Inc., Elkhart, USA) for Tobacco rattle virus (TRV) showed that the symptomatic plants were positive. Symptomatic spinach from the field was used for mechanical transmission to Chenopodium quinoa, C. murale, C. capitatum, spinach, and sugar beet (Beta vulgaris). All inoculated plants showed chlorotic local lesions and sugar beet showed chlorotic local lesions with rings. To further confirm the presence of TRV, reverse transcription-PCR (RT-PCR) was conducted. Total RNA was extracted from the mechanically inoculated symptomatic spinach plants using RNeasy Plant Kit (Qiagen Inc., Valencia, CA) and used as a template in RT-PCR using forward (5’- TACATCACATCTGCCTGC -3’) and reverse (5’- CTTCATTCACACAACCCTTG -3’) primers specific to the movement protein gene from the spinach isolate of TRV (GenBank Accession No. AJ007294). Amplicons of the expected size (approximately 562 bp) were obtained. The RT-PCR products were sequenced (GenBank Accession No. GU002156) and compared with TRV sequences in GenBank to confirm the identity of the products. Sequences obtained had 96% nucleotide identity and 97% amino acid identity with TRV sequences available under the GenBank Accession Nos. FJ357571 and AJ007294. Based on data from electron microscopy and serological and molecular analyses, the virus was identified as TRV. Soil samples collected from one of the fields were assayed for nematodes; however, Paratrichodorus or Trichodorus species were not observed. To our knowledge, this is the first report of TRV in spinach in California. TRV has also been reported in spinach in England and Germany.
|
|
|
|
|