|
|
|
 |
Title: Delayed emergence, stem distortion, stunting, and foliar symptoms associated with Tobacco Rattle Virus and Paratrichodorus allius in potatoes grown in the Pacific Northwest.
Authors
 | Gieck, S - OREGON STATE UNIVERSITY |  | David, N - OREGON STATE UNIVERSITY |  | Hamm, P - OREGON STATE UNIVERSITY |  |
Crosslin, James
|  | Ingham, R - OREGON STATE UNIVERSITY |
Submitted to: Plant Health Progress
Publication Type: Peer Reviewed Journal
Publication Acceptance Date: May 19, 2007
Publication Date: September 17, 2007
Citation: Gieck, S.L., David, N.L., Hamm, P.B., Crosslin, J., Ingham, R.E. 2007. Delayed emergence, stem distortion, stunting, and foliar symptoms associated with Tobacco Rattle Virus and Paratrichodorus allius in potatoes grown in the Pacific Northwest. Online. Plant Health Progress doi: 10.1094/PHP-2007-0917-01-BR.
Interpretive Summary: Stunted and deformed potato plants were observed in large, irregular patches in irrigated potato fields in Oregon in 2005. Some of these plants also showed various foliar symptoms including yellow rings and arcs which suggested a virus may be involved. Tests for all viruses except tobacco rattle virus were negative, suggesting this was the pathogen involved. Since TRV is transmitted by the soil-inhabiting stubby root nematode, soil samples were assayed for the nematode. The nematode was found in higher numbers in the affected parts of the fields. In 2006, similar symptoms were observed in additional fields. Again, the only pathogen associated with the stunted, deformed plants was TRV. Taken together, these results indicate that the foliar symptoms are indeed caused by infection with TRV and this is the first time that such foliar symptoms due to TRV infections have been documented in the Pacific Northwest.
Technical Abstract:
Stunted plants surrounding areas with delayed emergence were observed in May 2005 in an irrigated potato field in Morrow County, Oregon. Half of the field was planted with cv. Russet Norkotah and half with cv. Ranger Russet. The stunted plants often exhibited leaf chlorosis and yellow rings or chevrons. Foliar symptoms were more severe in Russet Norkotah, whereas more stunted plants or delayed emergence were present in Ranger Russet. Only a few tubers associated with the stunted plants showed internal symptoms of corky ringspot, caused by Tobacco rattle virus (TRV), which is vectored by the stubby-root nematode, (Paratrichodorus spp.). Field soil near the plants with and without foliar symptoms contained an average of 59 and 5 Paratrichodorus nematodes per 100 grams of dry soil, respectively. Leaf tissues of both varieties from the affected areas were positive by RT-PCR with primers TRV1 (5’ CAGTCTATACACAGAAACAGA 3’) and TRV2 (5’GACGTGTGTACTCAAGGGTT 3’), which amplify a portion of the 16K open reading frame on genomic RNA1. In contrast, tissues from symptomless plants were negative. Symptomatic Russet Norkotah samples that tested positive for TRV by RT-PCR with primers TRV1/TRV2 were negative for TRV by ELISA (antiserum ATCC PVAS 820) and RT-PCR with primers TRV CP1 (5’ATTAGGGATTCGGACGC 3’) and TRV CP2 (5’ ATCACAAGCGATGGTGG 3’) which target the coat protein gene on RNA2. This result suggests this was a non-multiplying (NM)-type isolate of TRV, which consists only of RNA1 and lacks the coat protein gene. This type of infection cannot, there fore, produce progeny nucleoprotein particles. The symptomatic plants also tested negative for other viruses, including potato virus Y, potato leafroll virus, alfalfa mosaic virus, tomato spotted wilt virus, and potato mop top virus. Mechanical inoculations of symptomatic Russet Norkotah leaf tissue to tobacco indicator plants were negative, supporting the hypothesis that an NM-type isolate was present. This is the first time that foliar symptoms due to TRV have been documented on potatoes in the Pacific Northwest.
|
|
|
|
|
|