Page Banner

United States Department of Agriculture

Agricultural Research Service

Title: Delayed emergence, severe stunting and foliar symptoms in potato due to tobacco rattle virus

Authors
item Crosslin, James
item Gieck, S - OREGON STATE UNIVERSITY
item David, N - OREGON STATE UNIVERSITY
item Hamm, P - OREGON STATE UNIVERSITY
item Ingham, R - OREGON STATE UNIVERSITY

Submitted to: Potato Association of America Proceedings
Publication Type: Proceedings
Publication Acceptance Date: June 1, 2006
Publication Date: February 1, 2007
Citation: Crosslin, J., Gieck, S.L., David, N.L., Hamm, P.B., Ingham, R.E. 2007. Delayed emergence, severe stunting and foliar symptoms in potato due to tobacco rattle virus. Potato Association of America Proceedings. American Journal of Potato Research. 84:85.

Technical Abstract: Stunted plants surrounding areas with delayed emergence were observed in May 2005 in an irrigated potato field in Morrow County, Oregon. Half of the field was planted with cv. Russet Norkotah (RN) and half with cv. Ranger Russet (RR). Stunted plants often exhibited leaf chlorosis and yellow rings or chevrons. Foliar symptoms were more severe in RN, while more stunted plants or delayed emergence were present in RR. Few tubers associated with stunted plants showed symptoms of corky ringspot, caused by Tobacco rattle virus (TRV) which is vectored by the stubby-root nematode, (Paratrichodorus spp.). Soil near plants with and without foliar symptoms contained an average of 59 and 5 Paratrichodorus spp./100 grams dry soil, respectively. Tissues of both varieties from affected areas were positive by RT-PCR with primers TRV1 (5’ CAGTCTATACACAGAAACAGA 3’) and TRV2 (5’GACGTGTGTACTCAAGGGTT 3’), whereas tissues from unaffected plants were not. Symptomatic RN samples positive for TRV with primers TRV1/TRV2 were negative for TRV by ELISA and RT-PCR with primers TRV CP1 (5’ATTAGGGATTCGGACGC 3’) and TRV CP2 (5’ ATCACAAGCGATGGTGG 3’) which target the coat protein region of the TRV genome, suggesting this was a non-multiplying (NM)-type isolate of TRV. Symptomatic plants were negative for other viruses. Mechanical inoculations of symptomatic RN tissue to tobacco were negative, supporting the hypothesis that an NM-type isolate was present. This is the first time foliar symptoms due to TRV have been observed on potatoes in the Pacific Northwest.

Last Modified: 4/20/2014
Footer Content Back to Top of Page