|
|
|
 |
Title: Genomic comparisons of bovine CYP3A28 of Angus, Brahman, and reciprocal crosses and milk characteristics
Authors
 | Reiter, S. - UNIV. OF ARKANSAS |  | Larsen, M. - UNIV. OF ARKANSAS |  | Okimoto, R. - UNIV. OF ARKANSAS |  | Brown, Michael |  | Brown, JR., H. - UNIV. OF ARKANSAS |  | Johnson, Z. - UNIV. OF ARKANSAS |  | Rosenkrans, JR., C. - UNIV. OF ARKANSAS |
Submitted to: American Society of Animal Science Southern Section Meeting
Publication Type: Abstract Only
Publication Acceptance Date: December 21, 2006
Publication Date: February 1, 2007
Citation: Reiter, S., Larsen, M., Okimoto, R., Brown, M.A., Brown, J., Johnson, Z., Rosenkrans, J. 2007. Genomic comparisons of bovine CYP3A28 of Angus, Brahman, and reciprocal crosses and milk characteristics [abstract]. American Society of Animal Science Southern Section Meeting, February 3-6, 2007, Moobile, AL. p. 1. Available on-line: http://www.asas.org/southern/meetings_past.asp.
Interpretive Summary: ABSTRACT ONLY
Technical Abstract:
Cytochrome P450s are a group of heme-containing monooxygenases necessary for the oxidative metabolism of foreign biological substances. Our goal was to determine the frequency of single nucleotide polymorphism (SNP) 994 in the CYP3A28 sequence of three breed types of cattle. The distribution of genotype among the breed types was compared to productivity traits while on endophyte-infected tall fescue as a means of investigating the interaction of cow genotype and ergot alkaloids. Genomic DNA was evaluated in 121 cows; the breed groups were Angus (n = 28), Brahman (n = 33), and Angus Brahman reciprocal crosses (n = 60). Specific primers for bovine CYP3A28 were used for PCR amplification (P450F: CAACAACATGAATCAGCCAGA; P450R: CCTACATTCCTGTGTGTGCAA) of a 565 base segment. Cytochrome P450 PCR products were then sequenced in 16 animals to establish the SNP and determine genotype. Restriction fragment length polymorphisms (RFLPs) using the Alu I restriction enzyme were used to determine the remainder of the genotypes. Results indicate that polymorphism distribution was associated (P < 0.05) breed lineage. Angus cows were 61 % heterozygous while 64 % of Brahman cows were homozygous cytosine. Milk volume, butterfat percent, and milk protein percent were affected (P < 0.07) by interactions of forage, genotype, and month of sampling. The number of somatic cell counts in milk were not affected (P > 0.2) by our CYP3A28 polymorphism. Our results indicate that SNP 994 in the CYP3A28 gene was related to milk production by beef cows. Additional analyses are necessary to determine if the polymorphism is associated with cattle susceptibility to ergot alkaloid poisoning.
|
|
|
|
|
|
|
Last Modified: 05/18/2013
|
|