Page Banner

United States Department of Agriculture

Agricultural Research Service

Title: Relationship between single nucleotide polymorphisms in the bovine heat shock protein 70 gene and milk characteristics of beef cows

Authors
item Lamb, M. - UNIV. OF ARKANSAS
item Okimoto, R. - COBB- VANTRESS, INC.
item Brown, Michael
item Brown, JR., H. - UNIV. OF ARKANSAS
item Johnson, Z. - UNIV. OF ARKANSAS
item Rosenkrans, JR., C. - UNIV. OF ARKANSAS

Submitted to: American Society of Animal Science Southern Section Meeting
Publication Type: Abstract Only
Publication Acceptance Date: December 21, 2006
Publication Date: February 2, 2007
Citation: Lamb, M., Okimoto, R., Brown, M.A., Brown, J., Johnson, Z., Rosenkrans, J. 2007. Relationship between single nucleotide polymorphisms in the bovine heat shock protein 70 gene and milk characteristics of beef cows [abstract]. American Society of Animal Science Southern Section Meeting, February 3-6, 2007, Mobile, AL. p. 2. Available on-line: http://www.asas.org/southern/meetings_past.asp.

Interpretive Summary: ABSTRACT ONLY

Technical Abstract: Heat shock proteins (HSPs) are induced by various stressors such as heat, cold, toxins, and oxygen deprivation. Our objective was to determine the genetic diversity in a segment of the HSP-70 gene of cattle. Genomic DNA was collected from 157 cows. The cows were Angus (n = 42), Brahman (n = 41), and Angus Brahman reciprocal crosses (n = 74). Specific primers for bovine HSP-70 (HSP1778F: CGCTGGAGTCGTACGCCTTC; HSP2326R: CTTGGAAGTAAACAGAAACGGG) were used for PCR amplification of a 523 base segment (based on GenBank accession number U09861). The PCR product was sequenced in both directions. Eight single nucleotide polymorphisms (SNPs) were identified. The SNPs were located at base position 1851 (n = 7; 4.5 %), 1899 (n = 1; 0.64 %), 1902 (n = 6; 3.8 %), 1917 (n = 6; 3.8 %), 1926 (n = 6; 3.8 %), 2033 (n = 22; 14 %), 2087 (n = 10; 6.4 %), and 2098 (n = 6; 3.8 %). Two SNPs were associated with altered milk characteristics. Cows that were heterozygous (CG) at the 2033 base had fewer (P < 0.05) somatic cells in their milk than homozygous GG cows (111 vs 305 x 1000 / mL). Cows that were homozygous at the 1902 base had greater (P < 0.05) percentages of butterfat and milk protein. These results indicate that the HSP-70 gene in cattle is polymorphic and related to milk characteristics. Polymorphisms within the HSP-70 gene may be useful as a tool in selecting superior cattle.

Last Modified: 9/2/2014
Footer Content Back to Top of Page