|
|
|
 |
|
Research Project:
GENETIC RESOURCES, EVALUATION AND INFORMATION MANAGEMENT OF WOODY LANDSCAPE PLANT GERMPLASM
Location: Floral and Nursery Plants Research Unit
Title: CONFIRMATION OF CROSS-POLLINATION BETWEEN VARIEGATED AND NON-VARIEGATED ARDISIA CRENATA
Authors
 | Roh, Mark |  | Lee, Ae-Kyung - DANKOOK UNIVERSITY,KOREA |  | Suh, Jeung Keun - DANKOOK UNIVERSITY,KOREA |  |
Slovin, Janet
|
Submitted to: Scientia Horticulturae
Publication Type: Peer Reviewed Journal
Publication Acceptance Date: May 2, 2006
Publication Date: July 3, 2006
Citation: Roh, M.S., Lee, A-K, Suh, J-K and Slovin, J. 2006. Confirmation of cross-pollination of Ardisia crenata by sequence-characterized amplified region (SCAR) markers. Scienta Horticultureae. 109:3.
Interpretive Summary: Ardisia species have been used as outdoor ornamental or indoor houseplants because of their bright red berries. Ardisia crenata is small evergreen shrub most commonly with non-variegated foliage and red berries. Seed reproduction biology of A. crenata and whether or not they are self-pollinated has not been investigated in detail. In greenhouse environments over the past 10 years, seedlings collected from a group of plants phenotypically identical in regards to berry color and foliage shape were true to the type of their mother plants suggesting out-crossing in the greenhouse did not occur. However, when seeds from one A. crenata plant with variegated foliage (VM) in an air conditioned greenhouse were germinated, seven seedlings (VSm) out of 261 seedlings did not show variegated leaves. Leaves were very similar to those with red berries (RM) and its seedlings and also white berries (WM) and its seedlings. The seven VSm seedlings could, therefore, result from cross-pollination with WM or RM, but the possibility of segregation from VM could not be excluded. These questions could not be answered by observing morphological characters, but may be answered using molecular markers. The hybrid origin of VSm could only be answered by molecular markers utilizing specific primers at an early growth stage. Hybrid origin of VSm seedlings between VM as a maternal source and WM as a paternal source is verified by polymerase chain reaction (PCR) using specific primers and these primers were successfully used to identify VM progenies with non-variegated leaves involving WM as a paternal source.
Technical Abstract:
To investigate the origin of seven A. crenata Sims seedlings with non-variegated foliages (VSm) from a progeny of a mother plant with variegated foliage (VM), morphological and genetic characteristics of these seedlings were compared with mother plants of A. crenata with variegated foliage (VM), plants with non-variegated leaves and white berries (WM), and plants with non-variegated leaves and red berries (RM). Genetic data includes randomly amplified polymorphic DNA (RAPD) markers and sequence analysis of an unidentified locus that was obtained from seven VSm seedlings, WM, and seedlings from WM (WS). RAPD analysis indicates that VM, WM and progeny populations VSm and WS are more closely related to each other than to RM and RM progeny (RS). Substitution in a 374-base long nucleotide sequence revealed that WM and most of WS and VSm produced similar sequence data with some exceptions, such as seedling VSm 2 and 5 showing polymorphisms at positions 7 (C replacing T) and 243 (A replacing T). Based on the RAPD and the sequence analysis for the VSm and WM specific band, it is concluded that these seven VSm seedlings were resulted from cross-pollination between VM and WM. Hybrid origin of VSm seedlings between VM as a maternal source and WM as a paternal source is verified by polymerase chain reaction (PCR) utilizing sequence-characterized amplified region (SCAR) markers (forward primer, ARD-1-F; GGACTGGAGTAGAGGATAGAGTTTTG and two reverse primers, ARD-2-R; GGACTGGAGTGCTCTATGAATTG and ARD-3-R; TGTCAGCAGCCTACCACTAGC) by cloning and sequencing of RAPD band. These SCAR markers can successfully be used to identify VM progenies with non-variegated leaves involving WM as a paternal source.
|
|
|
|
|
|
|
Last Modified: 06/17/2013
|
|