|
|
|
 |
Title: RAPID COMMUNICATION. ANDROGEN RECEPTOR (AR) MAPS TO XP1.1-Q1.1 IN THE PORCINE GENOME
Author
Submitted to: Journal of Animal Science
Publication Type: Abstract Only
Publication Acceptance Date: November 6, 1998
Publication Date: N/A
Technical Abstract:
Source of Clone. A porcine yeast artificial chromosome (YAC) library was screened by PCR with primers developed from the human AR sequence (GenBank number M20132 ) and a positive clone was identified. The amplified product was verified to be AR by sequence similarity to the human sequence. Total yeast DNA was used to physically assign the locus via fluorescence in situ hybridization to porcine metaphase chromosome spreads. Purified YAC DNA was then digested with Sau3AI, subcloned and screened for microsatellite repeats. Subclones containing microsatellites were sequenced and primers were developed to genotype the locus across the MARC porcine reference population as previously described. Two informative microsatellite markers associated with AR were developed from this YAC clone named SY6 and SY11. PCR Conditions. Reactions were conducted as previously described. The primers used to genotype SY6 and SY11 were: SY6F, ,CATTAGGGAAACTCTTGTTGGC; SY6R, TTTTCCAACCTTGGCTGG; SY11F, TTCACAGCATGACAAAATAGGG; and SY11R, TTCAGTCCACCAGAGTTCCC, respectively. Annealing temperatures were 58o C for SY6 and 55o C for SY11 Microsatellite polymorphisms. The size of alleles observed and frequencies (in parentheses) of each allele in nine parents of the MARC swine reference population for SY6 were 230 (.31) and 232 (.69) and for SY11 were 159 (.12) 165 (.19) and 169 (.69). Both markers displayed X-linked inheritance as males only possessed one allele in 86 progeny observed. Chromosome location. The results from the fluorescence in situ hybridization indicated that the YAC probe hybridized to X p1.1 on all metaphase spreads observed.
|
|
|
|
|
|
|
Last Modified: 05/21/2013
|
|