|
|
|
 |
Title: TWO CRINIVIRUSES ARE ASSOCIATED WITH THE STRAWBERRY PALLIDOSIS DISEASE
Authors
Submitted to: Acta Horticulturae
Publication Type: Proceedings
Publication Acceptance Date: May 13, 2004
Publication Date: September 25, 2004
Citation: Tzanetakis, I.E., Halgren, A.B., Keller, K.E., Wintermantel, W.M., Martin, R.R. 2004. Two criniviruses are associated with the strawberry pallidosis disease. Acta Horticulturae.
Interpretive Summary: In our effort to characterize strawberry pallidosis disease, we identified a single plant that was pallidosis positive, but not infected with Strawberry pallidosis associated virus, by grafting. Leaf grafts of this plant were performed onto Fragaria vesca UC-4 and UC-5 and Fragaria virginiana UC-10 and UC-11 indicator plants. The F. vesca plants remained asymptomatic while F. virginiana plants gave typical pallidosis symptoms that included marginal leaf chlorosis and epinasty. We extracted, cloned, and sequenced the dsRNA from the plant. We identified several clones that corresponded to the published sequence of Beet pseudo yellows virus (BPYV) heat shock protein 70 homologue gene (HSP70h). We transferred the isolate into Nicotiana benthamiana using the greenhouse whitefly. Using detection oligonucleotide primers BP CPm F ( 5' TTCATATTAAGGATGCGCAGA 3') and BP CPm R (5' TGAAAGATGTCCACTAATGATA 3'), we are able to amplify a 334 base pairs fragment of the CPm gene of the virus. Using this set of primers, we were able to verify the presence of the virus in the major strawberry producing areas of the U.S. including Florida, California, Oregon and the Mid-Atlantic states. The plants tested ranged from one to three years old, and the percentage infestation was the greatest in the Watsonville area of California where more than 20% of the plants tested were infected with BPYV. This is the second virus after strawberry pallidosis associated virus (SPaV) that can cause pallidosis symptoms on F. virginiana indicator plants.
Technical Abstract:
We have identified two closteroviruses belonging to the Crinivirus genus as potential causal agents of strawberry pallidosis disease. One is a newly described virus designated as Strawberry pallidosis associated virus (SPaV) while the second is Beet pseudo-yellows virus (BPYV). Both viruses are present in California, Eastern U.S., and may be present in other strawberry production regions as well. We have sequenced all the genes of both viruses, and phylogenetic analysis revealed that the two viruses are more closely related to each other than any other virus in the genus. Transmission studies have identified Trialeuroides vaporariorum, the greenhouse whitefly, as a potential vector of the SpaV while studies involving other whitefly species are in progress. We have developed polyclonal antibodies against the recombinant coat protein of SPaV that have been used successfully in tissue blots, but not ELISA. We are currently producing monoclonal antibodies to the virus and potentially to all Criniviruses.
|
|
|
|
|
|
|
Last Modified: 05/22/2013
|
|