ARS | Publication request: FIRST REPORT OF STRAWBERRY LATENT RINGSPOT VIRUS IN MENTHA FROM NORTH AMERICA

Submitted to: Plant Disease
Publication Type: Peer Reviewed Journal
Publication Acceptance Date: May 21, 2004
Publication Date: August 20, 2004
Citation: Postman, J.D., Tzanetakis, I.E., Martin, R.R. 2004. First report of strawberry latent ringspot virus in Mentha from North America. Plant Disease. 88:907.

Interpretive Summary: Experiments were carried out to determine if a yellow vein-banding symptom in several clones of mint in the National Clonal Germplasm Repository collection were caused by virus(es). Double-stranded RNA was extracted from symptomatic leaves and compared to dsRNA extracted from symptomless plants that had been derived from the plants with the yellow veinbanding symptom by heat treatment and meristem tip culture. DsRNA was present in the symptomatic but not in the symptomless plants. The dsRNA was cloned, partially sequenced, and compared to sequences in the DNA databases. From these comparisons, it was determined that the cloned sequence was from Strawberry latent ringspot virus (SLRSV), which is a European virus. Mint marketed in the nursery industry under names such as 'Golden Ginger Mint' and 'Green and Gold' were obtained from several nurseries and tested for the presence of SLRSV by reverse transcription-polymerase chain reaction (RT-PCR) using primers developed from the sequence obtained from the virus in mint. The RT-PCR test showed that SLRSV was present in nurseries from Maryland, Ohio, and Oregon. The virus also has been found recently in strawberry in several states as well as in Canada. The presence of SLRSV in these two widely planted vegetatively propagated crops demonstrates that this virus is widespread in North America.

Technical Abstract: Yellow veinbanding symptoms have been observed in several mint clones at the USDA-ARS, National Clonal Germplasm Repository (NCGR) mint collection in Corvallis, Oregon. The most dramatic symptoms are in a 'variegated' clone of Mentha gentilis L.(NCGR Accession MEN-454) that is marketed widely in the nursery industry under cultivar names such as 'Golden Ginger Mint' and 'Green and Gold'. The name Mentha x gentilis L. 'Variegata' has been proposed for forms of this species with the virus-induced variegation. Double-stranded RNA (dsRNA) was extracted from three mint clones with veinbanding symptoms of varying intensity. No dsRNA was obtained from a clone of M. gentilis that previously had yellow vein and was freed of this symptom by heat therapy and apical meristem culture. The dsRNA from MEN-454 was cloned and several clones corresponded to sequences of RNA 2 of Strawberry latent ringspot virus (SLRSV). Sequences of additional cDNA clones suggest the satellite RNA of SLRSV also was present in MEN-454. Based on the sequences of the SLRSV clones, primers F (5' CCTCTCCAACCTGCTAGACT 3') and R (5' AAGCGCATGAAGGTGTAACT 3') were developed and used in reverse transcription-polymerase chain reaction (RT-PCR) to amplify a 497 base fragment of RNA 2 of SLRSV. Variegated M. x gentilis clones were obtained from wholesale and mail-order nurseries in Maryland, Ohio, and Oregon. Samples were assayed for SLRSV by RT-PCR and all samples tested positive. Due to the presence of additional viruses, we cannot attribute yellow vein symptoms solely to SLRSV, however the presence of this virus in clones of M. x gentilis 'Variegata' from different regions throughout the United States demonstrates that SLRSV is widely distributed in the USA.