Skip to main content
ARS Home » Northeast Area » Washington, D.C. » National Arboretum » Floral and Nursery Plants Research » Research » Publications at this Location » Publication #263919
Title: Molecular markers associated with cold-hardiness in Camellia

Author
item JOUNG, YOUNG HEE - Chonnam National University
item Rowland, Lisa
item KIM, JAE-YOUNG - Rural Development Administration - Korea
item Roh, Mark

Submitted to: Acta Horticulturae
Publication Type: Peer Reviewed Journal
Publication Acceptance Date: 2/18/2013
Publication Date: 7/15/2013
Citation: Joung, Y., Rowland, L.J., Kim, J., Roh, M.S. 2013. Molecular markers associated with cold-hardiness in Camellia. Acta Horticulturae. 1000:415-422.

Interpretive Summary: Camellia, a genus of about 82 species of evergreen shrubs or trees belonging to the tea family (Theaceae), is native to tropical and subtropical Asia. The most common camellia, C. japonica L., is native to China, Korea, and Japan, and known for its beautiful, fragrant wax-like flowers. Many camellias are not cold hardy enough to be grown in USDA Zone 7, where temperatures can drop to -17oC. In the past, one-year-old twigs were used for laboratory cold hardiness testing by subjecting them to -18 to -20oC. However, it takes at least one or two years following seed germination to secure suitable twigs. Therefore, it is desirable to develop markers related to cold hardiness so that small amount of tissue can be used to extract DNA. The objectives of this study were to develop DNA markers for C. japonica associated with level of cold hardiness among a group of cold hardy and cold sensitive camellia genotypes. The Sequence-characterized amplified region (SCAR) markers from expressed sequence tag-polymerase chain reaction (EST-PCR) EST-SCAR-19839 primer pair proved useful for identifying non-cold hardy camellia plants, whereas the fragment amplified by the RAPD-based SCAR primers appeared monomorphic.

Technical Abstract: Sequence-characterized amplified region (SCAR) markers from expressed sequence tag-polymerase chain reaction (EST-PCR) and random amplified polymorphic DNA (RAPD) markers were developed with the goal to separate cold hardy camellias from non-cold hardy ones. A total of 28 cold hardy and non-cold hardy camellia genotypes were evaluated using 11 EST-PCR and 60 RAPD primers. One EST-PCR primer pair based on a Camellia sinensis sequence (here referred to as CAME 13; forward, 5’ - CGGGCAGGTACCTTCTGATA - 3’ and reverse, 5’ - TGCAGAAGATGGAGATGCAG - 3’) and one RAPD primer (Operon A-12) appeared to have potential for discriminating between the cold hardy and non-cold hardy genotypes. SCAR primer pairs were designed based on the sequence of the C. japonica bands amplified by the CAME 13 and Operon A-12 primers. The EST-SCAR-19839 primer pair (forward, 5’ - CGGGCAGGTACCTTCTGATA - 3’; reverse, 5’ - CCTCAGCCGTAGTTGCATTT - 3’) proved useful for identifying non-cold hardy camellia plants, whereas the fragment amplified by the RAPD-based SCAR primers appeared monomorphic.