Skip to main content
ARS Home » Research » Publications at this Location » Publication #236174

Title: First report of Candidatus Liberibacter psyllaurous in zebra chip symptomatic potatoes from California

Author
item Crosslin, James
item BESTER, G - FRITO LAY, INC.

Submitted to: Plant Disease
Publication Type: Peer Reviewed Journal
Publication Acceptance Date: 2/11/2009
Publication Date: 4/10/2009
Citation: Crosslin, J., Bester, G. 2009. First report of Candidatus Liberibacter psyllaurous in zebra chip symptomatic potatoes from California. Plant Disease. 93:551.

Interpretive Summary: A disease that severely affects processing potatoes (Solanum tuberosum L.), termed zebra chip (ZC), has been identified in several locations in the US, Mexico, and Central America. The disease name comes from the rapid oxidative darkening of fresh tubers when cut and the dark stripes and blotches seen in chips processed from infected tubers. Recently the disorder has been associated with a new Candidatus Liberibacter species in New Zealand and a bacterium designated Candidatus Liberibacter psyllaurous has been identified in plants with “psyllid yellows” symptoms which somewhat resemble those of ZC. Potato tubers of the variety ‘Dakota Pearl’, grown near Lancaster, in southern California, were found that had symptoms of ZC. Nucleic acid (DNA) was extracted from symptomatic tubers and tested by PCR for Ca. Liberibacter. Four of the five tubers with distinct ZC symptoms produced the expected PCR products. Nucleic acid from healthy potato tubers was not amplified with these primers. The PCR products were cloned and sequenced. Sequence analysis confirmed the presence of “Candidatus Liberibacter in the symptomatic tubers. Potato crops with symptoms of ZC have been observed in Texas, Nebraska, Colorado, Kansas, New Mexico, Arizona, Nevada, and California. This is the first report, however, of the specific detection of Candidatus Liberibacter psyllaurous from diseased potatoes grown in California.

Technical Abstract: A disease that severely affects processing potatoes (Solanum tuberosum L.), termed zebra chip (ZC), has been identified in several locations in the US, Mexico, and Central America. The disease name comes from the rapid oxidative darkening of fresh tubers when cut and the dark stripes and blotches seen in chips processed from infected tubers. Recently the disorder has been associated with a new Candidatus Liberibacter species in New Zealand and a bacterium designated Candidatus Liberibacter psyllaurous has been identified in plants with “psyllid yellows” symptoms which somewhat resemble those of ZC. In the fall of 2008, ten tubers were received at the Prosser laboratory from a commercial potato grower and five of these had symptoms characteristic of ZC. The tubers, cv. ‘Dakota Pearl’, were grown near Lancaster, in southern California. The tubers showed rapid oxidation upon slicing and the sunken stolon attachment characteristic of ZC. Nucleic acid was extracted from symptomatic tubers and tested by PCR for Ca. Liberibacter with primer pairs OA2/OI2c (GCGCTTATTTTTAATAGGAGCGGCA and GCCTCGCGACTTCGCAACCCAT, respectively) (16 S rDNA) and CL514F/R (CTCTAAGATTTCGGTTGGTT and TATATCTATCGTTGCACCAG, respectively) (ribosomal protein genes). Four of the five tubers with distinct ZC symptoms produced the expected amplicons with both primer pairs. Two additional tubers with mild internal discoloration produced amplicons of the correct size that were much less intense than that obtained from the severely affected tubers. Nucleic acid from healthy potato tubers was not amplified with these primers. The 1,168 bp OA2/OI2c and 669 bp CL514F/R amplicons from a strongly-positive sample were cloned into pCR2.1-Topo vector (Invitrogen, Carlsbad, CA) and one clone of each amplicon was sequenced in both directions (ACGT, Inc.; Wheeling, IL). BLAST alignments of the consensus sequences of the OA2/OI2c and CL514F/R amplicons (GenBank accessions FJ498802 and FJ498803, respectively) revealed 100% identity with other Ca. Liberibacter sequences reported from ZC-like potatoes in New Zealand (EU849020 and EU919514), and the OA2/OI2c amplicon was also identical to a sequence of Candidatus Liberibacter psyllaurous from psyllid yellows affected plants in the US (EU812559). The OA2/OI2c amplicon from the California tubers also showed a 99% homology with a Ca. Liberibacter species reported in ZC tubers from Kansas (accession EU921626). Potato crops with symptoms of ZC have been observed in Texas, Nebraska, Colorado, Kansas, New Mexico, Arizona, Nevada, and California. This is the first report, however, of the detection of Ca. Liberibacter psyllaurous from diseased potatoes grown in California.