Page Banner

United States Department of Agriculture

Agricultural Research Service

Related Topics

PCR and sequencing primers used for Fusarium graminearum
headline bar
Locus Primer Sequence

3-O-acetyltransferase
AT1 AAAATGGCTTTCAAGATACAGC
AT2 C(A/G)TA(C/T)TGCGC(A/G)TA(A/G)TTGGTCCA
AT3 TTGATGCTCGACCGGCAATGG
AT4 GTTGTGGTAGGTCATGTTTTG
AT6 ATCCATAGCACCGTGCTGTCC

phosphate permase
PHO1 ATCTTCTGGCGTGTTATCATG
PHO2 GACGTCAAAGGTGTAACGAGG
PHO3 TTCCAGCACTACAGCAAGTGG
PHO4 GTGCTGGAAGAAGTCTCTCC
PHO6 GATGTGGTTGTAAGCAAAGCCC

ammonia ligase
URA1 ATGAAGGTTGTTCTTGTGAGCGGCGG
URA3 TTTGTTCTCGATGACGGCGG
URA4 CGTTCGTAGTTTCCAAGATC
URA6 AATCCAATCCTGAATGGCGTC
URA7 ACAGACGCCATTCAGGATTGG
URA8 CTCTCCATTGATAATAGGGAC
URA10 GCAATCTTTGTGATGGTAGCTTGATC
URA11 GAGTATGCCCGCAACGTCATG
URA13 TTCAAGCCAGGCACCGAGTGG
URA14 ACTCGGACACCTTGGTCATCC
URA16 AATTATCTCATCGAGACATCC

putative reductase
RED1d TCTCAGAAAGACGCATATATG
RED2 CGTAACTGCGTCATTCGGC
RED11 CCC(A/G)AATTTAGTCTCCTTTAC
RED21 TGGCTC(T/G)GCCAATTCCATGGC

translation elongation factor
EF1T ATGGGTAAGGAGGACAAGAC
EF2T GGAAGTACCAGTGATCATGTT
EF11 GTGGGGCATTTACCCCGCC
EF22 AGGAACCCTTACCGAGCTC

beta-tubulin
T1 AACATGCGTGAGATTGTAAGT
T10 ACGATAGGTTCACCTCCAGAC
T21 GGTTTGCCAGAAAGCAGCACC
T22 TCTGGATGTTGTTGGGAATCC
T41 GCGATGAGCACTTACGCACTG
T121 CCACCTGTCTCCGTTTCCCCG
T222 GACCGGGGAAACGGAGACAGG

AT1 x AT2, PHO1 x PHO6, URA1 x URA6, URA7 x URA10, URA11 x URA16, RED1d x RED2, EF1T x EF2T and T1 x T22 were used as PCR primer pairs.

O'Donnell, K., H.C. Kistler, B.K. Tacke, and H.H. Casper. 2000. Gene genealogies reveal global phylogeographic structure and reproductive isolation among lineages of Fusarium graminearum, the fungus causing wheat scab. Proc. Natl. Acad. Sci. USA 97:7905-7910.


Last Modified: 10/7/2005
Footer Content Back to Top of Page